Skip to Content
Merck
All Photos(1)

Key Documents

EMU058681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Psmd4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGAGGCAAGATGGTGTTGGAGAGCACTATGGTTTGTGTGGACAACAGTGAGTACATGCGGAACGGAGACTTCCTTCCCACCCGGCTGCAGGCCCAGCAGGATGCCGTCAACATTGTATGTCACTCAAAGACCCGAAGCAACCCTGAGAATAACGTGGGCCTGATCACACTGGCCAATGACTGTGAGGTGCTGACCACACTCACCCCGGACACTGGCCGTATCCTCTCCAAGCTCCACACTGTCCAACCCAAAGGCAAGATCACCTTCTGCACTGGCATCCGCGTGGCCCACTTGGCTCTGAAGCACCGGCAGGGCAAGAATCACAAGATGCGCATCATCGCCTTTGTCGGTAGCCCTGTGGAGGACAACGAGAAGGATCTGGTGAAACTAGCTAAACGCCTTAAGAAAGAAAAAGTGAATGTTGACATCATTAATTTTGGGGAAGAGGAGGTGAACACAGAGAAGCTGACAGCCTTTGTGAACACACTGAATGGCAAGGATGGAACTGGGTCCCATCTAGTGACAGTGCCTCCTGGACCTAGCTTGGCTGATGCTCTCATCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Emma-Kate Loveday et al.
The Journal of general virology, 96(Pt 1), 30-39 (2014-09-23)
A common critical cellular event that many human enveloped viruses share is the requirement for proteolytic cleavage of the viral glycoprotein by furin in the host secretory pathway. For example, the furin-dependent proteolytic activation of highly pathogenic (HP) influenza A
Lin Wang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 22(12), 1079-1087 (2015-11-10)
Dihydrotanshinone I (DHTS) was previously reported to exhibit the most potent anti-cancer activity among several tanshinones in colon cancer cells. Its cytotoxic action was reactive oxygen species (ROS) dependent but p53 independent. To further study the anti-cancer activity of DHTS
T P H Nguyen et al.
Journal of molecular medicine (Berlin, Germany), 93(7), 795-805 (2015-02-27)
Fetal growth restriction (FGR) affects up to 5 % of pregnancies worldwide, and trophoblast function plays a significant role on the outcome. An epidemiological study has linked vitamin D deficiency to adverse perinatal outcomes, which include decreased birth weight. The

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service