Skip to Content
Merck
All Photos(1)

Key Documents

EMU008231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stim1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCTTATCAGCGTGGAGGACCTGTGGAAGGCGTGGAAATCATCAGAAGTGTACAACTGGACTGTGGATGAGGTGATACAGTGGCTCATTACGTATGTGGAGCTGCCACAGTATGAGGAGACCTTCCGGAAGTTGCAGCTTACTGGCCACGCCATGCCAAGGCTAGCAGTAACCAACACCACCATGACAGGGACTGTACTGAAGATGACAGATCGGAGCCACAGGCAGAAGCTGCAGCTGAAGGCCCTGGACACAGTGCTGTTTGGGCCTCCTCTCTTGACTCGGCATAATCACCTGAAGGACTTCATGCTGGTGGTGTCTATCGTTATTGGTGTGGGTGGCTGCTGGTTTGCCTATATCCAGAACCGTTACTCTAAGGAGCACATGAAGAAAATGATGAAGGATCTGGAAGGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ziying Han et al.
PLoS pathogens, 11(10), e1005220-e1005220 (2015-10-30)
Hemorrhagic fever viruses, including the filoviruses (Ebola and Marburg) and arenaviruses (Lassa and Junín viruses), are serious human pathogens for which there are currently no FDA approved therapeutics or vaccines. Importantly, transmission of these viruses, and specifically late steps of
J-Y Wang et al.
Oncogene, 34(33), 4358-4367 (2014-11-11)
Tumor metastasis is the major cause of death among cancer patients, with >90% of cancer-related death attributable to the spreading of metastatic cells to secondary organs. Store-operated Ca(2+) entry (SOCE) is the predominant Ca(2+) entry mechanism in most cancer cells
Raz Palty et al.
Cell research, 25(8), 963-980 (2015-07-04)
Calcium flux through store-operated calcium entry is a major regulator of intracellular calcium homeostasis and various calcium signaling pathways. Two key components of the store-operated calcium release-activated calcium channel are the Ca(2+)-sensing protein stromal interaction molecule 1 (STIM1) and the
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service