Skip to Content
Merck
All Photos(1)

Documents

EHU145511

Sigma-Aldrich

MISSION® esiRNA

targeting human STAG2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTATGCAGTCGGTGGTAGATGATTGGATAGAATCATACAAGCATGACCGAGATATAGCACTTCTTGACCTTATCAACTTTTTTATTCAGTGTTCAGGCTGTAAAGGAGTTGTCACAGCAGAAATGTTTAGACATATGCAGAACTCTGAGATAATTCGAAAAATGACTGAAGAATTCGATGAGGATAGTGGAGATTATCCACTTACCATGGCTGGTCCTCAGTGGAAGAAGTTCAAATCCAGTTTTTGTGAATTCATTGGCGTGTTAGTACGGCAATGTCAATATAGTATCATATATGATGAGTATATGATGGATACAGTCATTTCACTTCTTACAGGATTGTCTGACTCACAAGTCAGAGCATTTCGACATACAAGCACCCTGGCAGCTATGAAGTTGATGACAGCTTTGGTGAATGTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gourish Mondal et al.
Nature communications, 10(1), 1686-1686 (2019-04-13)
Cohesin is a multiprotein ring that is responsible for cohesion of sister chromatids and formation of DNA loops to regulate gene expression. Genomic analyses have identified that the cohesin subunit STAG2 is frequently inactivated by mutations in cancer. However, the
Marianna Kleyman et al.
Journal of cell science, 127(Pt 19), 4225-4233 (2014-07-31)
Mutations in the STAG2 gene are present in ∼20% of tumors from different tissues of origin. STAG2 encodes a subunit of the cohesin complex, and tumors with loss-of-function mutations are usually aneuploid and display elevated frequencies of lagging chromosomes during
Yi Chen et al.
Molecular oncology, 14(5), 1101-1117 (2020-03-03)
Ewing sarcomas (ESs) are aggressive sarcomas driven by EWS fusion genes. We sought to investigate whether whole-transcriptome sequencing (RNA-seq) could be used to detect patterns associated with chemotherapy response or tumor progression after first-line treatment. Transcriptome sequencing (RNA-seq) of 13

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service