Skip to Content
Merck
All Photos(1)

Documents

EHU075381

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM17

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTATAATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTTGTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGAAGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGAGCTTGTTCATCGAGTGAAAAGAAGAGCTGACCCAGATCCCATGAAGAACACGTGTAAATTATTGGTGGTAGCAGATCATCGCTTCTACAGATACATGGGCAGAGGGGAAGAGAGTACAACTACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGACATCTATCGGAACACTTCATGGG

Ensembl | human accession no.

ENSG00000151694

NCBI accession no.

NM_003183

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADAM17(6868) , ADAM17(6868)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Junsuke Uwada et al.
Cellular signalling, 35, 188-196 (2017-04-17)
Intestinal epithelial cells form a tight barrier to act as selective physical barriers, repelling hostile substances. Tumor necrosis factor-α (TNF-α) is a well characterized pro-inflammatory cytokine which can compromise intestinal barrier function and the suppression of TNF-α function is important
Jacob J Orme et al.
Oncoimmunology, 9(1), 1744980-1744980 (2020-05-05)
ADAM10 and ADAM17 expression and soluble PD-L1 (sPD-L1) predict poor prognosis in many malignancies, including in patients treated with PD-(L)1 inhibitors. The mechanism of soluble PD-L1 production and its effects are unknown. Here we uncover a novel mechanism of ADAM10-
Jie Liu et al.
International journal of biological sciences, 15(2), 493-506 (2019-02-13)
CD9 is a trans-membrane protein, and has recently been implicated in different physiological and cellular processes, such as cell migration and adhesion. According to previous study, down-regulation of CD9 contributes to keratinocyte migration, critical for wound re-epithelialization. Nevertheless, it is
Min Xu et al.
International journal of oncology, 49(6), 2520-2528 (2016-10-26)
Although a disintegrin and metalloproteinase-17 (ADAM17) overexpression has been demonstrated in numerous human tumors including gastric cancer, its role in gastric cancer development remains to be clarified. In the present study, we identify that ADAM17 activates TGF-β/Smad signaling to promote
Qi Zhang et al.
Biochemical and biophysical research communications, 503(4), 2333-2339 (2018-07-03)
We investigated the role of a disintegrin and metalloproteinase 17 (ADAM17) in chemo resistance, and to clarify the mechanism underlying reverse of L-OHP resistance by knockdown of ADAM17. CRC tissues with corresponding adjacent normal tissues were collected. The mRNA and
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service