Skip to Content
Merck
All Photos(1)

Documents

EHU073361

Sigma-Aldrich

MISSION® esiRNA

targeting human PSEN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTTTGGCAATTCTTCTTCTCAAGCACTGACACTCATTACCGTCTGTGATTGCCATTTCTTCCCAAGGCCAGTCTGAACCTGAGGTTGCTTTATCCTAAAAGTTTTAACCTCAGGTTCCAAATTCAGTAAATTTTGGAAACAGTACAGCTATTTCTCATCAATTCTCTATCATGTTGAAGTCAAATTTGGATTTTCCACCAAATTCTGAATTTGTAGACATACTTGTACGCTCACTTGCCCCAGATGCCTCCTCTGTCCTCATTCTTCTCTCCCACACAAGCAGTCTTTTTCTACAGCCAGTAAGGCAGCTCTGTCGTGGTAGCAGATGGTCCCATTATTCTAGGGTCTTACTCTTTGTATGATGAAAAGAATGTGTTATGAATCGGTGCTGTCAGCCCTGCTGTCAGACCTTCTTCCACAGCAAATGAGATGTATGCCCAAAGACGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Min-Hong Hsieh et al.
Molecules (Basel, Switzerland), 25(2) (2020-01-17)
Osteosarcoma, which is the most prevalent malignant bone tumor, is responsible for the great majority of bone cancer-associated deaths because of its highly metastatic potential. Although tomatidine is suggested to serve as a chemosensitizer in multidrug-resistant tumors, the anti-metastatic effect
Hongyu Zhang et al.
Frontiers in immunology, 11, 999-999 (2020-06-27)
Objective: Cancer-associated fibroblasts (CAFs) were associated with tumor progression in the tumor microenvironment (TME). However, their immunosuppressive roles in protecting cancer cells from the attack by cytotoxic T lymphocytes (CTLs) are not fully clear. In this study, we investigated whether
Sun-Ok Yoon et al.
Apoptosis : an international journal on programmed cell death, 19(11), 1616-1626 (2014-08-27)
Activating mutations in the NOTCH1 gene are found in over 50 % of T-ALL cases. Since Notch signaling contributes to the leukemia cell survival and growth, targeting Notch signaling using γ-secretase inhibitors (GSI) has been proposed as a molecularly targeted
Hannah Brautigam et al.
Scientific reports, 5, 17042-17042 (2015-11-27)
The presenilin 1 (PSEN1) L271V mutation causes early-onset familial Alzheimer's disease by disrupting the alternative splicing of the PSEN1 gene, producing some transcripts harboring the L271V point mutation and other transcripts lacking exon 8 (PS1(∆exon8)). We previously reported that PS1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service