Skip to Content
Merck
All Photos(1)

Documents

EHU061351

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4L

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCTGCCACGGACAACTACACCCTTCAGATCAACCCTAATTCAGGCCTCTGTAATGAGGATCATTTGTCCTACTTCACTTTTATTGGAAGAGTTGCTGGTCTGGCCGTATTTCATGGGAAGCTCTTAGATGGTTTCTTCATTAGACCATTTTACAAGATGATGTTGGGAAAGCAGATAACCCTGAATGACATGGAATCTGTGGATAGTGAATATTACAACTCTTTGAAATGGATCCTGGAGAATGACCCTACTGAGCTGGACCTCATGTTCTGCATAGACGAAGAAAACTTTGGACAGACATATCAAGTGGATTTGAAGCCCAATGGGTCAGAAATAATGGTCACAAATGAAAACAAAAGGGAATATATCGACTTAGTCATCCAGTGGAGATTTGTGAACAGGGTCCAGAAGCAGATG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kimberly Gomez et al.
Molecular brain, 14(1), 20-20 (2021-01-23)
Voltage-gated sodium channels are key players in neuronal excitability and pain signaling. Functional expression of the voltage-gated sodium channel NaV1.7 is under the control of SUMOylated collapsin response mediator protein 2 (CRMP2). When not SUMOylated, CRMP2 forms a complex with
Neil J Grimsey et al.
Cell reports, 24(12), 3312-3323 (2018-09-21)
Ubiquitination is essential for protein degradation and signaling and pivotal to many physiological processes. Ubiquitination of a subset of G-protein-coupled receptors (GPCRs) by the E3 ligase NEDD4-2 is required for p38 activation, but how GPCRs activate NEDD4-2 to promote ubiquitin-mediated
Jonathan R Hughes et al.
Frontiers in cell and developmental biology, 8, 607060-607060 (2020-12-08)
8-Oxoguanine DNA glycosylase (OGG1) is the major cellular enzyme required for the excision of 8-oxoguanine DNA base lesions in DNA through the base excision repair (BER) pathway, and therefore plays a major role in suppressing mutagenesis and in controlling genome
Yuan Wang et al.
Biochemical and biophysical research communications, 531(4), 581-587 (2020-08-20)
The ubiquitin-proteasome system (UPS) is composed of E1 ubiquitin-activating enzyme, E2 ubiquitin-conjugating enzyme, and E3 ubiquitin ligase, which play a fundamental role in mediating intracellular protein degradation. Ferroptosis is a non-apoptotic regulated cell death caused by iron accumulation and subsequent
Dong-Eun Lee et al.
Cell death & disease, 11(1), 38-38 (2020-01-22)
In mammals, autophagosome formation is initiated by ULK1 via the posttranslational modification of this protein. However, the precise role of ULK1 ubiquitination in modulating autophagy is unknown. Here, we show that NEDD4L, an E3 ubiquitin ligase, binds ULK1 in pancreatic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service