Skip to Content
Merck
All Photos(1)

Documents

EHU033701

Sigma-Aldrich

MISSION® esiRNA

targeting human BNIP3L

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTACCCATGAACAGCAGCAATGGCAATGATAATGGCAATGGGAAAAATGGGGGGCTGGAACACGTACCATCCTCATCCTCCATCCACAATGGAGACATGGAGAAGATTCTTTTGGATGCACAACATGAATCAGGACAGAGTAGTTCCAGAGGCAGTTCTCACTGTGACAGCCCTTCGCCACAAGAAGATGGGCAGATCATGTTTGATGTGGAAATGCACACCAGCAGGGACCATAGCTCTCAGTCAGAAGAAGAAGTTGTAGAAGGAGAGAAGGAAGTCGAGGCTTTGAAGAAAAGTGCGGACTGGGTATCAGACTGGTCCAGTAGACCCGAAAACATTCCACCCAAGGAGTTCCACTTCAGACACCCTAAACGTTCTGTGTCTTTAAGCATGAGGAAAAGTGGAGCCATGA

Ensembl | human accession no.

ENSG00000104765

NCBI accession no.

NM_004331

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BNIP3L(665) , BNIP3L(665)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chen Yan et al.
Cancer letters, 388, 34-42 (2016-12-04)
Cancer stem cells (CSCs) are known to be drug resistant. Mitophagy selectively degrades unnecessary or damaged mitochondria by autophagy during cellular stress. To investigate the potential role of mitophagy in drug resistance in CSCs, we purified CD133
Dan Xu et al.
American journal of physiology. Renal physiology, 316(2), F382-F395 (2018-09-13)
Proteinuria, the most common symptom of renal injury, is an independent factor for renal tubular injury. However, the underlying mechanism remains to be fully elucidated. Mitochondrion is an important target for proteinuria-induced renal tubular cell injury. Insufficient mitophagy exacerbates cell
Sajid Naeem et al.
Toxicology letters, 326, 1-10 (2020-03-07)
Our previous study demonstrated that cadmium (Cd) is an effective inducer of mitophagy, which is mainly mediated by PINK1/Parkin pathway. However, the role of other mitophagy pathways in Cd-induced mitophagy remains elusive. The present study employed HeLa cells, lacking fully
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service