Skip to Content
Merck
All Photos(1)

Key Documents

EHU147001

Sigma-Aldrich

MISSION® esiRNA

targeting human DGAT1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCCTGAACTGGTGTGTGGTGATGCTGATCTTGAGCAATGCCCGGTTATTTCTGGAGAACCTCATCAAGTATGGCATCCTGGTGGACCCCATCCAGGTGGTTTCTCTGTTCCTGAAGGATCCCTATAGCTGGCCCGCCCCATGCCTGGTTATTGCGGCCAATGTCTTTGCTGTGGCTGCATTCCAGGTTGAGAAGCGCCTGGCGGTGGGTGCCCTGACGGAGCAGGCGGGACTGCTGCTGCACGTGGCCAACCTGGCCACCATTCTGTGTTTCCCAGCGGCTGTGGTCTTACTGGTTGAGTCTATCACTCCAGTGGGCTCCCTGCTGGCGCTGATGGCGCACACCATCCTCTTCCTCAAGCTCTTCTCCTACCGCGACGTCAACTCATGGTGCCGCAGGGCCAGGGCCAAGGCTGCCTCTGCAGGGAAGAAGGCCAGCAGTGCTGCTGCCCCGCACACCGTGAGCTACCCGGACAATCTGACCTACCGCGATCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls
Pil Soo Sung et al.
Journal of virology, 88(16), 9233-9244 (2014-06-06)
Diacylglycerol acyltransferase-1 (DGAT1) is involved in the assembly of hepatitis C virus (HCV) by facilitating the trafficking of the HCV core protein to the lipid droplet. Here, we abrogated DGAT1 expression in Huh-7.5 cells by using either the transcription activator-like

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service