Skip to Content
Merck
All Photos(1)

Key Documents

EHU009611

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGGAGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATGTGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGGATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTGATTTTAATGGCCACATCTAATCTCATTTCACATGAAAGAAGAAGTATATTTTAGAAATTTGTTAATGAGAGTAAAAGAAAATAAATGTGTATAGCTCAGTTTGGATAATTGGTCAAACAATTTTTTATCCAGTAGTAAAATATGTAACCATTGTCCCAGTAAAGAAAAATAACAAAAGTTGTAAAATGTATATTCTCCCTTTTATATTGCATCTGCTGTTACCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaori Huang et al.
Oncology letters, 17(3), 3425-3431 (2019-03-15)
Increasing number of microRNAs (miRNAs) have been reported to play an important role in the development and progression of non-small cell lung cancer (NSCLC). In particular, microRNA-497-5p (miR-497-5p) has been proposed as a tumor suppressor miRNA in human cancers. However
Z-F Chen et al.
European review for medical and pharmacological sciences, 24(12), 6707-6715 (2020-07-08)
This study was designed to investigate whether microRNA-936 can be involved in the development of gastric cancer (GCa) by down-regulating FGF2 expression and activating the phosphatidylinositol 3-kinase/protein kinase B (P13K/Akt) signaling pathway. Quantitative polymerase chain reaction (qPCR) was carried out
Jingzhe Yang et al.
The Journal of surgical research, 259, 261-270 (2020-11-10)
Keloid is a benign fibroproliferative tumor of the skin caused by abnormal wound healing process after skin injury. Long noncoding RNAs have been reported to be involved in the development of keloid. However, the role and mechanism of nuclear enriched
Long He et al.
Journal of cancer research and therapeutics, 14(7), 1519-1524 (2018-12-28)
The objective of the study is to investigate the role of basic fibroblast growth factor (bFGF) in sensitivity to cisplatin in non-small cell lung cancer (NSCLC) A549 cells and its effect on the stemness characteristics of NSCLC cells, revealing possible
Yantao Han et al.
Cell biology international, 41(12), 1296-1306 (2017-08-10)
Vascular smooth muscle cell (VSMC) proliferation is a major contributor to atherosclerosis. This study investigated the inhibitory effects of oleanolic acid (OA) against oxidized low-density lipoprotein (ox-LDL)-induced VSMC proliferation in A7r5 cells and explored underlying molecular mechanism. The cell proliferation

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service