Skip to Content
Merck
All Photos(1)

Key Documents

EHU155921

Sigma-Aldrich

MISSION® esiRNA

targeting human LOX

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCAAAGAGTGAAAAACCAAGGGACATCAGATTTCTTACCCAGCCGACCAAGATATTCCTGGGAATGGCACAGTTGTCATCAACATTACCACAGTATGGATGAGTTTAGCCACTATGACCTGCTTGATGCCAACACCCAGAGGAGAGTGGCTGAAGGCCACAAAGCAAGTTTCTGTCTTGAAGACACATCCTGTGACTATGGCTACCACAGGCGATTTGCATGTACTGCACACACACAGGGATTGAGTCCTGGCTGTTATGATACCTATGGTGCAGACATAGACTGCCAGTGGATTGATATTACAGATGTAAAACCTGGAAACTATATCCTAAAGGTCAGTGTAAACCCCAGCTACCTGGTTCCTGAATCTGACTATACCAACAATGTTGTGCGCTGTGACAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

T Osawa et al.
British journal of cancer, 109(8), 2237-2247 (2013-09-21)
Molecules that are highly expressed in tumour endothelial cells (TECs) may be candidates for specifically targeting TECs. Using DNA microarray analysis, we found that the lysyl oxidase (LOX) gene was upregulated in TECs compared with its expression in normal endothelial
Roozbeh Khosravi et al.
PloS one, 9(6), e100669-e100669 (2014-06-28)
Lysyl oxidase is a multifunctional enzyme required for collagen biosynthesis. Various growth factors regulate lysyl oxidase during osteoblast differentiation, subject to modulation by cytokines such as TNF-α in inflammatory osteopenic disorders including diabetic bone disease. Canonical Wnt signaling promotes osteoblast
Roseli da Silva et al.
PloS one, 10(3), e0119781-e0119781 (2015-03-20)
Lysyl oxidase (LOX) is involved in vital biological processes such as cell motility, cell signaling and gene regulation. Deregulation of this protein can contribute to tumor formation and progression. Although it is known that LOX is involved in invasion, proliferation
Rolf Schreckenberg et al.
Frontiers in physiology, 8, 556-556 (2017-08-22)
Purpose: According to the current therapeutic guidelines of the WHO physical activity and exercise are recommended as first-line therapy of arterial hypertension. Previous results lead to the conclusion, however, that hearts of spontaneously hypertensive rats (SHR) with established hypertension cannot
D H Peng et al.
Oncogene, 36(14), 1925-1938 (2016-10-04)
Lung cancer is the leading cause of cancer-related deaths, primarily due to distant metastatic disease. Metastatic lung cancer cells can undergo an epithelial-to-mesenchymal transition (EMT) regulated by various transcription factors, including a double-negative feedback loop between the microRNA-200 (miR-200) family

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service