Skip to Content
Merck
All Photos(1)

Key Documents

EHU092331

Sigma-Aldrich

MISSION® esiRNA

targeting human VAMP7 (1)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTGTGAAACTTGAAAGAGAATAGACAGTATGACATATAGAATTAATACAAAACAGTTTAACAACCATTTAACTGCAGTGTAAGAAAATTGGACTGTAATCATATCGCTACTGGCATCTGTTATCTAGTATGCATTTCTGGTGTGTATCTGAAAGGAAGACATTTTCTACCCTAGATCCAATTGCATTTATTTATCAATAAGTGCCATTAAATTGAAATTATATTACATTTTACACTTTCTCAATGAATGAACAAATTAGTCTGTAGAATCTAGCCACCTGTTTAGCCTAGTCATGTGCCTTGAACATATATGTGTCCCATAATCTGGCTCATGGTACCTGTTCTTCTATCCAAACCTTTCAATTCATGCTACCTGATTCATTTATTTGACATAGATCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Praneeth Chitirala et al.
Frontiers in immunology, 10, 1855-1855 (2019-08-27)
Cytotoxic T lymphocytes kill infected or malignant cells through the directed release of cytotoxic substances at the site of target cell contact, the immunological synapse. While genetic association studies of genes predisposing to early-onset life-threatening hemophagocytic lymphohistiocytosis has identified components
Juan José Saez et al.
Cells, 10(2) (2021-02-13)
LAT is an important player of the signaling cascade induced by TCR activation. This adapter molecule is present at the plasma membrane of T lymphocytes and more abundantly in intracellular compartments. Upon T cell activation the intracellular pool of LAT
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service