Skip to Content
Merck
All Photos(1)

Key Documents

EHU000041

Sigma-Aldrich

MISSION® esiRNA

targeting human KDELR1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGCCATCATCTTGCTACTGCTCAAAATCTGGAAGTCCCGCTCGTGCGCCGGAATTTCAGGGAAGAGCCAGGTCCTGTTTGCTGTGGTGTTCACTGCCCGATATCTGGACCTCTTCACCAACTACATCTCACTCTACAACACGTGTATGAAGGTGGTCTACATAGCCTGCTCCTTCACCACGGTCTGGTTGATTTATAGCAAGTTCAAAGCTACTTACGATGGGAACCATGACACGTTCAGAGTGGAGTTCCTGGTCGTTCCCACAGCCATTCTGGCGTTCCTGGTCAATCATGACTTCACCCCTCTGGAGATCCTCTGGACCTTCTCCATCTACCTGGAGTCAGTGGCCATCTTGCCGCAGCTGTTCATGGTGAGCAAGACCGGCGAGGCGGAGACCATCACCAGCCACTACTTGTTTGCGCTAGGCGTTTACCGCACGCTCTATCTCTTCAACTGGATCTGGCGCTACCATTTCGAGGGCTTCTTCGACCTCATCGCCATTGTGGCAGGCCTGGTCCAGACAGTCCTCTACTGCGATTTCTTCTACCTCTATATCACCAAAGTCCTAAAGGGGAAGAAGTTGAGTTTGCCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Raji Lenin et al.
Scientific reports, 9(1), 10783-10783 (2019-07-28)
Increased O-GlcNAcylation, a well-known post-translational modification of proteins causally linked to various detrimental cellular functions in pathological conditions including diabetic retinopathy (DR). Previously we have shown that endothelial activation induced by inflammation and hyperglycemia results in the endoplasmic reticulum (ER)
Kerrie L Marie et al.
Nature communications, 11(1), 333-333 (2020-01-18)
Cutaneous malignant melanoma is an aggressive cancer of melanocytes with a strong propensity to metastasize. We posit that melanoma cells acquire metastatic capability by adopting an embryonic-like phenotype, and that a lineage approach would uncover metastatic melanoma biology. Using a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service