Skip to Content
Merck
All Photos(1)

Documents

EMU023701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nox4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGAAGAACCCAAGTTCCAAGCTCATTTCCCACAGACCTGGATTTGGATTTCTGGACCTTTGTGCCTTTATTGTGCGGAGAGACTTTACCGATGCATCAGGAGCAACAAACCTGTCACCATCATCTCAGTCATCAATCATCCCTCTGATGTAATGGAACTCCGTATGATCAAAGAAAACTTTAAAGCAAGACCTGGCCAGTATATTATTCTCCATTGCCCCAGTGTATCAGCATTAGAAAACCACCCATTTACTCTCACAATGTGTCCTACTGAAACCAAAGCAACATTTGGTGTCCACTTTAAAGTAGTAGGAGACTGGACAGAACGATTCCGGGATTTGCTACTGCCTCCATCAAGTCAAGACTCTGAGATTCTGCCCTTCATTCACTCTAGAAATTACCCTAAGTTATACATTGATGGTCCATTTGGAAGCCCATTTGAGGAGTCA

Ensembl | mouse accession no.

ENSMUSG00000030562

NCBI accession no.

NM_015760

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... NOX4(50490) , Nox4(50490)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Aleksandr E Vendrov et al.
Antioxidants & redox signaling, 23(18), 1389-1409 (2015-06-10)
Increased oxidative stress and vascular inflammation are implicated in increased cardiovascular disease (CVD) incidence with age. We and others demonstrated that NOX1/2 NADPH oxidase inhibition, by genetic deletion of p47phox, in Apoe(-/-) mice decreases vascular reactive oxygen species (ROS) generation
Motoya Tanaka et al.
Oncology reports, 34(4), 1726-1732 (2015-08-05)
Malignant pleural mesothelioma (MPM) is an aggressive tumor that is characterized by dysregulated growth and resistance to apoptosis. Reactive oxygen species (ROS)-generating NADPH oxidase (Nox) family enzymes have been suggested to be involved in neoplastic proliferation. Both the antioxidant N-acetylcysteine
Jin-Ran Chen et al.
The Journal of biological chemistry, 290(23), 14692-14704 (2015-04-30)
Bone remodeling is age-dependently regulated and changes dramatically during the course of development. Progressive accumulation of reactive oxygen species (ROS) has been suspected to be the leading cause of many inflammatory and degenerative diseases, as well as an important factor
Cheng-Chang Yeh et al.
Clinical oral investigations, 19(6), 1463-1471 (2014-12-04)
Triethylene glycol dimethacrylate (TEGDMA) is a common component of resin-based dental composites and endodontic sealers. TEGDMA induces apoptosis in several types of cells. However, the mechanisms are not completely understood. The aim of this study was to investigate the mechanisms
Nabil A Rashdan et al.
American journal of physiology. Heart and circulatory physiology, 309(10), H1655-H1666 (2015-09-27)
Placental growth factor (PLGF), a potent stimulator of arteriogenesis, is upregulated during outward arterial remodeling. Increased fluid shear stress (FSS) is a key physiological stimulus for arteriogenesis. However, the role of FSS in regulating PLGF expression is unknown. To test
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service