Skip to Content
Merck
All Photos(1)

Key Documents

EHU092581

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG7

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGTCAAACAGAAGGAGTCACAGCTCTTCCTTACTTCTTAATCAAGTATGATGAGAACATGGTGCTGGTTTCCTTGCTTAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACGAAGATAACAATTGGTGTATATGATCCCTGTAACTTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTAGCAGCCCACAGATGGAGTAGCAGTTTCCAGTCTGTTGAAGTTGTTTGCTTCCGTGACCGTACCATGCAGGGGGCGAGAGACGTTGCCCACAGCATCATCTTCGAAGTGAAGCTTCCAGAAATGGCATTTAGCCCAGATTGTCCTAAAGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGACCAAGGATGGTGAACCTCAG

Ensembl | human accession no.

ENSG00000197548

NCBI accession no.

NM_006395

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATG7(10533) , ATG7(10533)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chao Zhang et al.
Journal of experimental & clinical cancer research : CR, 36(1), 162-162 (2017-11-18)
Glioblastoma multiforme (GBM) is characterized by lethal aggressiveness and patients with GBM are in urgent need for new therapeutic avenues to improve quality of life. Current studies on tumor invasion focused on roles of cytokines in tumor microenvironment and numerous
Zhuhui Qiao et al.
Cell death discovery, 6, 31-31 (2020-05-08)
Autophagy is a process involving the self-digestion of components that participates in anti-oxidative stress responses and protects cells against oxidative damage. However, the role of autophagy in the anti-oxidative stress responses of melanocytes remains unclear. To investigate the role of
Paul Zarogoulidis et al.
Molecular oncology, 10(10), 1516-1531 (2016-10-04)
Chemoresistance is a major challenge in lung cancer treatment. Recent findings have revealed that autophagic mechanism contributes significantly to immunosuppressive related chemoresistance. For that reason, targeting autophagy-related immunosuppression is an important approach to reverse tumor drug resistance. In this study
Hai-Yan Zhu et al.
Biochemical and biophysical research communications, 516(4), 1265-1271 (2019-07-16)
Leukemia remains a fatal disease for most patients and effective therapeutic strategies are urgently required. Typhaneoside (TYP) is a major flavonoid in the extract of Pollen Typhae, showing significant biological and pharmacological effects. In the present study, we explored the
Pandian Nagakannan et al.
Free radical biology & medicine, 101, 53-70 (2016-11-05)
Oxidative damage and aggregation of cellular proteins is a hallmark of neuronal cell death after neurotrauma and chronic neurodegenerative conditions. Autophagy and ubiquitin protease system are involved in degradation of protein aggregates, and interruption of their function is linked to
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service