Skip to Content
Merck
All Photos(1)

Key Documents

EHU013251

Sigma-Aldrich

MISSION® esiRNA

targeting human SULT2A1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTTTGACCACATTCATGGCTGGATGCCCATGAGAGAGGAGAAAAACTTCCTGTTACTGAGTTATGAGGAGCTGAAACAGGACACAGGAAGAACCATAGAGAAGATCTGTCAATTCCTGGGAAAGACGTTAGAACCCGAAGAACTGAACTTAATTCTCAAGAACAGCTCCTTTCAGAGCATGAAAGAAAACAAGATGTCCAATTATTCCCTCCTGAGTGTTGATTATGTAGTGGACAAAGCACAACTTCTGAGAAAAGGTGTATCTGGGGACTGGAAAAATCACTTCACAGTGGCCCAAGCTGAAGACTTTGATAAATTGTTCCAAGAGAAGATGGCAGATCTTCCTCGAGAGCTGTTCCCATGGGAATAACGTCCAAAACACTCTGGATCTTATATGGAGAATGACATTGATTCTCCTGTCCTTGTACATGTACCTGACTGGGGTCATTGTGTAAGACTTATTATTTTATCCTGAAACCTTAAATATCAAACCTCTGCATCTCTGATCCCTTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S Stojkovic et al.
Journal of thrombosis and haemostasis : JTH, 12(6), 948-957 (2014-04-08)
Urokinase-type plasminogen activator (u-PA) plays a pivotal role in extracellular proteolysis and is thought to be critically involved in the modulation of angiogenesis. Interleukin (IL)-33 is a member of the IL-1 cytokine family, which is thought to act as danger
Xi-Xiang Yu et al.
Digestive diseases and sciences, 60(5), 1265-1272 (2015-02-07)
As a pro-inflammatory cytokine, IL-33 has been demonstrated to play an important role in tumor progression. It is reported that IL-33 is highly expressed in the serum and tumor tissues of patients with gastric cancer. However, the function of IL-33

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service