Skip to Content
Merck
All Photos(1)

Key Documents

EHU113851

Sigma-Aldrich

MISSION® esiRNA

targeting human PABPC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTCCTAAATGATCGCAAAGTATTTGTTGGACGATTTAAGTCTCGTAAAGAACGAGAAGCTGAACTTGGAGCTAGGGCAAAAGAATTCACCAATGTTTACATCAAGAATTTTGGAGAAGACATGGATGATGAGCGCCTTAAGGATCTCTTTGGCAAGTTTGGGCCTGCCTTAAGTGTGAAAGTAATGACTGATGAAAGTGGAAAATCCAAAGGATTTGGATTTGTAAGCTTTGAAAGGCATGAAGATGCACAGAAAGCTGTGGATGAGATGAACGGAAAGGAGCTCAATGGAAAACAAATTTATGTTGGTCGAGCTCAGAAAAAGGTGGAACGGCAGACGGAACTTAAGCGCAAATTTGAACAGATGAAACAAGATAGGATCACCAGATACCAGGGTGTTAATCTTTATGTGAAAAATCTTGATGATGGTATTGATGATGAACGTCTCCGGAAAGAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qiao Xue et al.
Pathogens (Basel, Switzerland), 9(6) (2020-06-10)
Seneca Valley Virus (SVV) is an oncolytic virus of the Picornaviridae family, which has emerged in recent years. The impact of SVV on host cell translation remains unknown. Here, we showed, for the first time, that SVV infection cleaved poly(A)
Xia Jiang et al.
PloS one, 9(7), e101993-e101993 (2014-07-08)
Despite the development and availability of hepatitis A virus (HAV) vaccine, HAV infection is still a major cause of acute hepatitis that occasionally leads to fatal liver disease. HAV internal ribosomal entry-site (IRES) is one of the attractive targets of
Nicola Guzzi et al.
Cell, 173(5), 1204-1216 (2018-04-10)
Pseudouridylation (Ψ) is the most abundant and widespread type of RNA epigenetic modification in living organisms; however, the biological role of Ψ remains poorly understood. Here, we show that a Ψ-driven posttranscriptional program steers translation control to impact stem cell commitment during

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service