Skip to Content
Merck
All Photos(1)

Documents

EHU074371

Sigma-Aldrich

MISSION® esiRNA

targeting human DRD2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCTGGAGATGGAGATGCTCTCCAGCACCAGCCCACCCGAGAGGACCCGGTACAGCCCCATCCCACCCAGCCACCACCAGCTGACTCTCCCCGACCCGTCCCACCATGGTCTCCACAGCACTCCCGACAGCCCCGCCAAACCAGAGAAGAATGGGCATGCCAAAGACCACCCCAAGATTGCCAAGATCTTTGAGATCCAGACCATGCCCAATGGCAAAACCCGGACCTCCCTCAAGACCATGAGCCGTAGGAAGCTCTCCCAGCAGAAGGAGAAGAAAGCCACTCAGATGCTCGCCATTGTTCTCGGCGTGTTCATCATCTGCTGGCTGCCCTTCTTCATCACACACATCCTGAACATACACTGTGACTGCAACATCCCGCCTGTCCTGTACAGCGCCTTCACGTGGCTGGGCTATGTCAACAGCGCCGTGAACCCCATCATCTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongli Huang et al.
International immunopharmacology, 39, 113-120 (2016-07-29)
Dopamine (DA), an important neurotransmitter, has been reported to play a negative role in tumor progression. DA acts its role via dopamine receptors (DRs), which can be divided into five receptor subtypes (D1R-D5R). Among these receptor subtypes, D2R has been
Carole Deyts et al.
PloS one, 4(12), e8287-e8287 (2009-12-18)
Huntington's disease (HD) is a polyglutamine-expanded related neurodegenerative disease. Despite the ubiquitous expression of expanded, polyQ-Huntingtin (ExpHtt) in the brain, striatal neurons present a higher susceptibility to the mutation. A commonly admitted hypothesis is that Dopaminergic inputs participate to this
N Shioda et al.
Molecular psychiatry, 22(8), 1205-1222 (2016-12-07)
Aberrant dopamine D
Yanrong Zhang et al.
PloS one, 7(6), e38745-e38745 (2012-06-22)
Renal dopamine receptors participate in the regulation of blood pressure. Genetic factors, including polymorphisms of the dopamine D(2) receptor gene (DRD2) are associated with essential hypertension, but the mechanisms of their contribution are incompletely understood. Mice lacking Drd2 (D(2)-/-) have
Jie Li et al.
Oncotarget, 5(4), 882-893 (2014-03-25)
Glioblastoma remains one of the deadliest of human cancers, with most patients succumbing to the disease within two years of diagnosis. The available data suggest that simultaneous inactivation of critical nodes within the glioblastoma molecular circuitry will be required for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service