Skip to Content
Merck
All Photos(1)

Key Documents

EHU031571

Sigma-Aldrich

MISSION® esiRNA

targeting human APOBEC3A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGGACACAGACCAGGAACCGAGAAGGGACAAGCACATGGAAGCCAGCCCAGCATCCGGGCCCAGACACTTGATGGATCCACACATATTCACTTCCAACTTTAACAATGGCATTGGAAGGCATAAGACCTACCTGTGCTACGAAGTGGAGCGCCTGGACAATGGCACCTCGGTCAAGATGGACCAGCACAGGGGCTTTCTACACAACCAGGCTAAGAATCTTCTCTGTGGCTTTTACGGCCGCCATGCGGAGCTGCGCTTCTTGGACCTGGTTCCTTCTTTGCAGTTGGACCCGGCCCAGATCTACAGGGTCACTTGGTTCATCTCCTGGAGCCCCTGCTTCTCCTGGGGCTGTGCCGGGGAAGTGCGTGCGTTCCTTCAGGAGAACACACACGTGAGACTGCGTATCTTCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Emad Y Alqassim et al.
Communications biology, 4(1), 102-102 (2021-01-24)
Pro-inflammatory M1 macrophage polarization is associated with microbicidal and antitumor responses. We recently described APOBEC3A-mediated cytosine-to-uracil (C > U) RNA editing during M1 polarization. However, the functional significance of this editing is unknown. Here we find that APOBEC3A-mediated cellular RNA editing can
Yang Yang et al.
The Journal of investigative dermatology, 137(4), 810-818 (2016-11-29)
Apolipoprotein B mRNA-editing catalytic polypeptide (APOBEC) 3 proteins have been identified as potent viral DNA mutators and have broad antiviral activity. In this study, we demonstrated that apolipoprotein B mRNA-editing catalytic polypeptide 3A (A3A) and A3G expression levels were significantly

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service