Skip to Content
Merck
All Photos(1)

Key Documents

EHU018921

Sigma-Aldrich

MISSION® esiRNA

targeting human MYBBP1A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCTCCCAAAGCAGTTCAAGTTTGCCCCAGAGATGGACGATTACGTGGGCACCTTCCTAGAGGGGTGCCAGGATGACCCTGAGCGGCAGCTGGCCGTGCTAGTGGCCTTCTCATCTGTCACCAACCAAGGCCTCCCTGTCACGCCTACTTTCTGGCGGGTCGTGCGGTTCCTGAGCCCTCCGGCCCTGCAGGGCTATGTGGCCTGGCTGCGGGCCATGTTTCTCCAGCCAGACCTGGACTCCTTGGTTGACTTCAGCACCAACAACCAGAAGAAAGCCCAGGATTCATCGCTCCACATGCCTGAGCGAGCTGTGTTCCGGCTGAGGAAATGGATCATCTTTCGATTGGTGAGCATTGTGGACAGCCTGCACCTGGAGATGGAGGAGGCCTTGACTGAGCAGGTGGCCAGGTTTTGTTTGTTCCACTCGTTCTTTGTCACAAAGAAGCCCACATCCCAGATCCCTGAGACAAAGCACCCGTTCTCCTTCCCTTTGGAAAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Blanca Felipe-Abrio et al.
Molecular oncology, 13(7), 1519-1533 (2019-05-09)
The tumor microenvironment may alter the original tumorigenic potential of tumor cells. Under harsh environmental conditions, genetic alterations conferring selective advantages may initiate the growth of tumor subclones, providing new opportunities for these tumors to grow. We performed a genetic
Blanca Felipe-Abrio et al.
Cancers, 11(2) (2019-02-20)
Tumors are cellular ecosystems where different populations and subpopulations of cells coexist. Among these cells, cancer stem cells (CSCs) are considered to be the origin of the tumor mass, being involved in metastasis and in the resistance to conventional therapies.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service