Skip to Content
Merck
All Photos(1)

Documents

EHU009051

Sigma-Aldrich

MISSION® esiRNA

targeting human DDIT4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTACTGCGCCTGGCCTACAGCGAGCCGTGCGGCCTGCGGGGGGCGCTGCTGGACGTCTGCGTGGAGCAGGGCAAGAGCTGCCACAGCGTGGGCCAGCTGGCACTCGACCCCAGCCTGGTGCCCACCTTCCAGCTGACCCTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCAGGGGCTGTTTAGCTCCGCCAACTCTCCCTTCCTCCCTGGCTTCAGCCAGTCCCTGACGCTGAGCACTGGCTTCCGAGTCATCAAGAAGAAGCTGTACAGCTCGGAACAGCTGCTCATTGAGGAGTGTTGAACTTCAACCTGAGGGGGCCGACAGTGCCCTCCAAGACAGAGACGACTGAACTTTTGGGGTGGAGACTAGAGGCAGGAGCTGAGGGACTGATTCCTGTGGTTGGAAAACTGAGGCAGCCACCTAA

Ensembl | human accession no.

ENSG00000168209

NCBI accession no.

NM_019058

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DDIT4(54541) , DDIT4(54541)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bowen Wang et al.
Investigative ophthalmology & visual science, 60(8), 2836-2847 (2019-07-03)
To assess how DNA damage-inducible transcript 4 (DDIT4) and autophagic flux are altered in dry eye disease and reveal the underlying mechanisms. C57BL/6 mice were exposed to desiccating stress (subcutaneous scopolamine [0.5 mg/0.2 mL] 3 times a day, humidity <
Aistė Savukaitytė et al.
Cancer management and research, 13, 1123-1133 (2021-02-13)
Mutations within genes encoding components of the PI3K/AKT/mTOR (phosphoinositide 3-kinase/protein kinase B/mechanistic target of rapamycin) signaling axis frequently activate the pathway in breast cancer, making it an attractive therapeutic target. Inhibition of mTORC1 (mechanistic target of rapamycin complex 1) activity
Peng Li et al.
Biochemical and biophysical research communications, 519(1), 179-185 (2019-09-09)
Oxidative stress plays a significant role involved in myocardial ischemia/reperfusion (MI/R) injury. The regulated in development and DNA damage response 1 (REDD1) is an mTORC1 inhibitor participating in response to hypoxia and oxidative stress. However, whether and how REDD1 is
Oscar Alvarez-Garcia et al.
Arthritis & rheumatology (Hoboken, N.J.), 69(7), 1418-1428 (2017-03-24)
Regulated in development and DNA damage response 1 (REDD1) is an endogenous inhibitor of mechanistic target of rapamycin (mTOR) that regulates cellular stress responses. REDD1 expression is decreased in aged and osteoarthritic (OA) cartilage, and it regulates mTOR signaling and
Emilie Jaune et al.
Cell death & disease, 12(1), 64-64 (2021-01-13)
In the search of biguanide-derived molecules against melanoma, we have discovered and developed a series of bioactive products and identified the promising new compound CRO15. This molecule exerted anti-melanoma effects on cells lines and cells isolated from patients including the
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service