Skip to Content
Merck
All Photos(1)

Key Documents

EHU147451

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF31, RP11-468E2.4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTTGAAGGAGAAGCACATCACAGACATGGTGTGCCCTGCCTGTGGCCGCCCCGACCTCACCGATGACACACAGTTGCTCAGCTACTTCTCTACCCTTGACATCCAGCTTCGCGAGAGCCTAGAGCCAGATGCCTATGCGTTGTTCCATAAGAAGCTGACCGAGGGTGTGCTGATGCGGGACCCCAAGTTCTTGTGGTGTGCCCAGTGCTCCTTTGGCTTCATATATGAGCGTGAGCAGCTGGAGGCAACTTGTCCCCAGTGTCACCAGACCTTCTGTGTGCGCTGCAAGCGCCAGTGGGAGGAGCAGCACCGAGGTCGGAGCTGTGAGGACTTCCAGAACTGGAAACGCATGAACGACCCAGAATACCAGGCCCAGGGCCTAGCAATGTATCTTCAGGAAAACGGCATTGACTGCCCCAAATGCAAGTTCTCGTACGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed
Meraj H Khan et al.
Journal of cell science, 130(18), 3094-3107 (2017-08-05)
Sharpin, a multifunctional adaptor protein, regulates several signalling pathways. For example, Sharpin enhances signal-induced NF-κB signalling as part of the linear ubiquitin assembly complex (LUBAC) and inhibits integrins, the T cell receptor, caspase 1 and PTEN. However, despite recent insights
Eva M van Well et al.
The EMBO journal, 38(9) (2019-03-20)
Neurodegenerative diseases are characterized by the accumulation of misfolded proteins in the brain. Insights into protein quality control mechanisms to prevent neuronal dysfunction and cell death are crucial in developing causal therapies. Here, we report that various disease-associated protein aggregates

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service