Skip to Content
Merck
All Photos(1)

Key Documents

EHU147561

Sigma-Aldrich

MISSION® esiRNA

targeting human PKM

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACG

Ensembl | human accession no.

ENSG00000067225

NCBI accession no.

NM_002654

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PKM(5315) , PKM2(5315)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pu-Hyeon Cha et al.
British journal of cancer, 124(3), 634-644 (2020-10-20)
Most cancer cells employ the Warburg effect to support anabolic growth and tumorigenesis. Here, we discovered a key link between Warburg effect and aberrantly activated Wnt/β-catenin signalling, especially by pathologically significant APC loss, in CRC. Proteomic analyses were performed to
Hai Hu et al.
Journal of Cancer, 11(8), 2022-2031 (2020-03-05)
Macrophages play a critical role in the initiation and progression in various human solid tumors; however, their role and transformation in pancreatic ductal adenocarcinoma (PDAC) were still illusive. Here, immunohistochemistry was used to determine CD206 (specific marker of M2 macrophage)
Guo-Bin Ding et al.
Polymers, 12(2) (2020-02-23)
Polyethylenimine (PEI) is a gold standard polymer with excellent transfection efficacy, yet its severe toxicity and nondegradability hinders its therapeutic application as a gene delivery vector. To tackle this problem, herein we incorporated the biodegradable polylactide (PLA) into the branched
Qingran Li et al.
Molecular & cellular proteomics : MCP, 17(8), 1531-1545 (2018-05-10)
Butyrate is a short chain fatty acid present in a high concentration in the gut lumen. It has been well documented that butyrate, by serving as an energetic metabolite, promotes the proliferation of normal colonocytes while, by serving as a
Yong Liu et al.
Oncotarget, 8(43), 75206-75216 (2017-11-02)
Platinum-based chemotherapeutic drugs are irreplaceable for the treatment of advanced non-small cell lung cancer (NSCLC). However, acquired drug resistance has become a major obstacle for the clinical application of chemotherapy on NSCLC. In the present study, we established carboplatin-resistant NSCLC
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service