Skip to Content
Merck
All Photos(1)

Key Documents

EHU137721

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACGAGAAAGAGTGCCTCAAGTACCAGGTGCCCCTGCCCGACAGCATGAAGCTGGAGTCGTCCCACTCCCGTGGCAGCATGACCGCCCTGGGTGGAGCCTCCTCGTCGACCCACCACCCCATCACCACCTACCCGCCCTACGTGCCCGAGTACAGCTCCGGACTCTTCCCCCCCAGCAGCCTGCTGGGCGGCTCCCCCACCGGCTTCGGATGCAAGTCCAGGCCCAAGGCCCGGTCCAGCACAGGCAGGGAGTGTGTGAACTGTGGGGCAACCTCGACCCCACTGTGGCGGCGAGATGGCACGGGACACTACCTGTGCAACGCCTGCGGGCTCTATCACAAAATGAACGGACAGAACCGGCCCCTCATTAAGCCCAAGCGAAGGCTGTCTGCAGCCAGGAGAGCAGGGACGTCCTGTGCGAACTGTCAGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yinghua Xu et al.
Oncotarget, 8(66), 110517-110529 (2018-01-05)
Lung adenocarcinoma (LAC) is the leading cause of cancer-related death worldwide. Aberrant expression of genes expressed preferentially in the lung tumor vasculature may yield clues for prognosis and treatment. Von Willebrand factor (vWF) is a large multifunctional glycoprotein with a
Shuangqin Wei et al.
Cancer management and research, 9, 769-780 (2017-12-22)
GATA3, a member of the GATA zinc finger transcription factor family, has been widely investigated for its role in cancer. Although a recent report has found that GATA3 is downregulated in gastric cancer (GC), the detailed mechanism of GATA3 in
Linjie Ma et al.
OncoTargets and therapy, 11, 7579-7589 (2018-11-23)
GATA3 functions as a tumor suppressor and has been observed in multiple types of cancer, but the effects and mechanisms of GATA3 in osteosarcoma (OS) are not yet known. The GATA3 expression in OS cells and tissues were detected using
Mingjun Bi et al.
Nature cell biology, 22(6), 701-715 (2020-05-20)
Acquired therapy resistance is a major problem for anticancer treatment, yet the underlying molecular mechanisms remain unclear. Using an established breast cancer cellular model, we show that endocrine resistance is associated with enhanced phenotypic plasticity, indicated by a general downregulation
P Shahi et al.
Oncogene, 36(40), 5567-5575 (2017-06-06)
Semaphorin 3B (SEMA3B) is a secreted axonal guidance molecule that is expressed during development and throughout adulthood. Recently, SEMA3B has emerged as a tumor suppressor in non-neuronal cells. Here, we show that SEMA3B is a direct target of GATA3 transcriptional

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service