Skip to Content
Merck
All Photos(1)

Key Documents

EHU094671

Sigma-Aldrich

MISSION® esiRNA

targeting human TDP1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAATGCCATGCCACATATTAAGACATATATGAGGCCTTCTCCAGACTTCAGTAAAATTGCTTGGTTCCTTGTCACAAGCGCAAATCTGTCCAAGGCTGCCTGGGGAGCATTGGAGAAGAATGGCACCCAGCTGATGATCCGCTCCTACGAGCTCGGGGTCCTTTTCCTCCCTTCAGCATTTGGTCTAGACAGTTTCAAAGTGAAACAGAAGTTCTTCGCTGGCAGCCAGGAGCCAATGGCCACCTTTCCTGTGCCATATGATTTGCCTCCAGAACTGTATGGAAGTAAAGATCGGCCATGGATATGGAACATTCCTTATGTCAAAGCACCGGATACGCATGGGAACATGTGGGTGCCCTCCTGAGAATCTTGAGGCACTGTGAAATTTAAGTGTAAGACATTGAGCCACAAACATGGAATC

Ensembl | human accession no.

ENSG00000042088

NCBI accession no.

NM_018319

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TDP1(55775) , TDP1(55775)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Benu Brata Das et al.
Nucleic acids research, 42(7), 4435-4449 (2014-02-05)
Poly(ADP-ribose) polymerases (PARP) attach poly(ADP-ribose) (PAR) chains to various proteins including themselves and chromatin. Topoisomerase I (Top1) regulates DNA supercoiling and is the target of camptothecin and indenoisoquinoline anticancer drugs, as it forms Top1 cleavage complexes (Top1cc) that are trapped
Alejandro Álvarez-Quilón et al.
Molecular cell, 78(6), 1152-1165 (2020-06-10)
The APEX2 gene encodes APE2, a nuclease related to APE1, the apurinic/apyrimidinic endonuclease acting in base excision repair. Loss of APE2 is lethal in cells with mutated BRCA1 or BRCA2, making APE2 a prime target for homologous recombination-defective cancers. However
Sourav Saha et al.
Cell reports, 33(13), 108569-108569 (2020-12-31)
The present study demonstrates that topoisomerase 3B (TOP3B) forms both RNA and DNA cleavage complexes (TOP3Bccs) in vivo and reveals a pathway for repairing TOP3Bccs. For inducing and detecting cellular TOP3Bccs, we engineer a "self-trapping" mutant of TOP3B (R338W-TOP3B). Transfection with
Curtis W Bacon et al.
Molecular cell, 78(6), 1133-1151 (2020-05-14)
Precise control of the RNA polymerase II (RNA Pol II) cycle, including pausing and pause release, maintains transcriptional homeostasis and organismal functions. Despite previous work to understand individual transcription steps, we reveal a mechanism that integrates RNA Pol II cycle

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service