Skip to Content
Merck
All Photos(1)

Key Documents

EHU054171

Sigma-Aldrich

MISSION® esiRNA

targeting human PTPN14

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCGCTAATGAGCCTTTGCTTTTCTTTGGAGTCATGTTCTATGTGCCAAATGTGTCATGGCTTCAGCAAGAGGCCACAAGATATCAGTATTACCTGCAAGTCAAAAAAGATGTGCTTGAAGGGCGATTACGATGTACATTGGACCAGGTGATTCGGCTAGCCGGCCTAGCTGTGCAAGCTGATTTTGGAGACTATAATCAGTTTGATTCTCAAGATTTCCTCAGAGAGTATGTGCTATTTCCTATGGATTTGGCCCTGGAAGAGGCTGTTCTGGAGGAGCTGACCCAGAAGGTAGCCCAAGAACACAAAGCCCACAGTGGAATCCTGCCAGCAGAAGCTGAACTGATGTACATCAATGAAGTTGAACGTTTGGATGGATTTGGACAGGAAATCTTCCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Natalia I Díaz-Valdivia et al.
Oncogene, 39(18), 3693-3709 (2020-03-11)
Caveolin-1 (CAV1) enhanced migration, invasion, and metastasis of cancer cells is inhibited by co-expression of the glycoprotein E-cadherin. Although the two proteins form a multiprotein complex that includes β-catenin, it remained unclear how this would contribute to blocking the metastasis
Ana Lonic et al.
The Journal of cell biology, 220(2) (2021-01-08)
Receptor degradation terminates signaling by activated receptor tyrosine kinases. Degradation of EGFR occurs in lysosomes and requires the switching of RAB5 for RAB7 on late endosomes to enable their fusion with the lysosome, but what controls this critical switching is
Yujie Yang et al.
British journal of pharmacology, 178(7), 1524-1540 (2021-01-22)
Disturbed flow induces endothelial dysfunction and contributes to uneven distribution of atherosclerotic plaque. Emerging evidence suggests that harmine, a natural constituent of extracts of Peganum harmala, has potent beneficial activities. Here, we investigated if harmine has an atheroprotective role under

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service