Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU004421

Sigma-Aldrich

MISSION® esiRNA

targeting human BMI1, COMMD3-BMI1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCATCCTTCTGCTGATGCTGCCAATGGCTCTAATGAAGATAGAGGAGAGGTTGCAGATGAAGATAAGAGAATTATAACTGATGATGAGATAATAAGCTTATCCATTGAATTCTTTGACCAGAACAGATTGGATCGGAAAGTAAACAAAGACAAAGAGAAATCTAAGGAGGAGGTGAATGATAAAAGATACTTACGATGCCCAGCAGCAATGACTGTGATGCACTTAAGAAAGTTTCTCAGAAGTAAAATGGACATACCTAATACTTTCCAGATTGATGTCATGTATGAGGAGGAACCTTTAAAGGATTATTATACACTAATGGATATTGCCTACATTTATACCTGGAGAAGGAATGGTCCACTTCCATTGAAATACAGAGTTCGACCTACTTGTAAAAGAATGAAGATCAGTCACCAGAGAGATGGACTGACAAATGCTGGAGAACTGGAAAGTGACTCTGGGAGTGACAAGGCCAACAGCCCAGCAGGAGGTATTCCCTCCACCTCTTCTTGTTTGCCTAGCCCCAGTACTCCAGTGCAGTCTCCTCATCCA

Ensembl | human accession no.

ENSG00000168283

NCBI accession no.

NM_005180

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BMI1(100532731) , BMI1(648)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

M Hiraki et al.
Oncogene, 36(20), 2791-2801 (2016-11-29)
B-cell-specific Moloney murine leukemia virus integration site 1 (BMI1) is a component of the polycomb repressive complex 1 (PRC1) complex that is overexpressed in breast and other cancers, and promotes self-renewal of cancer stem-like cells. The oncogenic mucin 1 (MUC1)
Fan Xu et al.
Experimental and therapeutic medicine, 14(3), 2216-2220 (2017-10-01)
The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin
Valentina Casa et al.
Human molecular genetics, 26(4), 753-767 (2017-01-04)
Repression of repetitive elements is crucial to preserve genome integrity and has been traditionally ascribed to constitutive heterochromatin pathways. FacioScapuloHumeral Muscular Dystrophy (FSHD), one of the most common myopathies, is characterized by a complex interplay of genetic and epigenetic events.
M H Shahi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(11), 15107-15114 (2016-09-25)
Chemoresistance is a common hurdle for the proper treatment of gliomas. The role of Shh-Gli1 signaling in glioma progression has been reported. However, its role in glioma chemoresistance has not been well studied yet. In this work, we found that
Hexiang Wang et al.
Biochemical and biophysical research communications, 537, 22-28 (2021-01-01)
Triple-negative breast cancer (TNBC) is a major challenge in clinical practice due to its aggressiveness and lack of targeted treatment. Cancer stem-like traits contribute to tumorigenesis and immune privilege of TNBC. However, the relationship of stemness and immunosurveillance remains unclear.
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service