Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU008271

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM6B

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCGAAGAACCATCACATCATCAAGTTTGGCACCAACATCGACTTGTCTGATGCTAAGCGGTGGAAGCCCCAGCTGCAGGAGCTGCTGAAGCTGCCCGCCTTCATGCGGGTAACATCCACGGGCAACATGCTGAGCCACGTGGGCCACACCATCCTGGGCATGAACACGGTGCAGCTGTACATGAAGGTGCCCGGCAGCCGAACGCCAGGCCACCAGGAGAATAACAACTTCTGCTCCGTCAACATCAACATTGGCCCAGGCGACTGCGAGTGGTTCGCGGTGCACGAGCACTACTGGGAGACCATCAGCGCTTTCTGTGATCGGCACGGCGTGGACTACTTGACGGGTTCCTGGTGGCCAATCCTGGATGATCTCTATGCATCCAATATTCCTGTGTACCGCTTCGTGCAGCGACCCGGAGACCTCGTGTGGATTAATGCGGGGACTGTGCACTGGGTGCAGGCCACCGGCTGGTGCAACAACATTGCCTGGAACGTGGGGCCCCTCACCGCCTATCAGTACCAGCTGGC

Ensembl | human accession no.

ENSG00000132510

NCBI accession no.

NM_001080424

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KDM6B(23135) , JMJD3(23135)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jianchun Wu et al.
Oncology reports, 34(1), 455-460 (2015-05-23)
Mammary stem cells (MSCs) are the progenitor population for human breast epithelia. MSCs give rise during mammary gland development to estrogen receptor (ER)-negative basal cells and the ER- luminal progenitor (LP) population which maintains ER+ and ER- luminal cells. The
Wanwan Jia et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 4031-4042 (2018-02-27)
Rheumatoid arthritis (RA) is an immune-mediated disease with the characteristics of progressive joint destruction, deformity, and disability. Epigenetic changes have been implicated in the development of some autoimmune disorders, resulting in an alteration of gene transcription. Here, we investigated how
Hiroyuki Imuta et al.
Heart and vessels, 35(12), 1746-1754 (2020-07-18)
Macrophages play a crucial role in the development of atherosclerosis. To explore the mechanism by which macrophages attain a proinflammatory phenotype for a sustained period, we stimulated macrophages with lipopolysaccharide (LPS) and interferon-γ (IFN-γ) and measured the interleukin-1β (IL-1β) expression.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service