Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU012051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnf

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTCCGGGCAGGTCTACTTTGGAGTCATTGCTCTGTGAAGGGAATGGGTGTTCATCCATTCTCTACCCAGCCCCCACTCTGACCCCTTTACTCTGACCCCTTTATTGTCTACTCCTCAGAGCCCCCAGTCTGTGTCCTTCTAACTTAGAAAGGGGATTATGGCTCAGAGTCCAACTCTGTGCTCAGAGCTTTCAACAACTACTCAGAAACACAAGATGCTGGGACAGTGACCTGGACTGTGGGCCTCTCATGCACCACCATCAAGGACTCAAATGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAGTGGTCAGGTTGCCTCTGTCTCAGAATGAGGCTGGATAAGATCTCAGGCCTTCCTACCTTCAGACCTTTCCAGACTCTTCCCTGAGGTGC

Ensembl | nº de acceso | ratón

ENSMUSG00000024401

Nº de acceso NCBI

NM_013693

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... TNF(21926) , Tnf(21926)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
UBV
IBS
XWR
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Valentina Pileczki et al.
International journal of molecular sciences, 14(1), 411-420 (2012-12-25)
Tumor necrosis factor alpha (TNF-α) is a pro-inflammatory cytokine involved in the promotion and progression of cancer, including triple negative breast cancer cells. Thus, there is significant interest in understanding the molecular signaling pathways that connect TNF-α with the survival
Li Peng et al.
The International journal of artificial organs, 38(10), 565-571 (2015-11-07)
Periprosthetic osteolysis, involving RANK/RANKL/osteoprotegerin (OPG) and TNF-α/NFκB signaling, contributes to bone resorption and inflammation. We constructed lentivirus vectors to inhibit TNF-α and enhance OPG expression and assessed their impacts on wear debris-induced inflammation and osteoclastogenesis in an osteoclast/osteoblast coculture system.
Hank Cheng et al.
Journal of neuroinflammation, 13, 19-19 (2016-01-27)
The basis for air pollution-associated neurodegenerative changes in humans is being studied in rodent models. We and others find that the ultrafine particulate matter (PM) derived from vehicular exhaust can induce synaptic dysfunction and inflammatory responses in vivo and in
Wenwen Zheng et al.
Molecular pain, 7, 40-40 (2011-05-24)
HIV-associated sensory neuropathy (HIV-SN) is one of the most common forms of peripheral neuropathy, affecting about 30% of people with acquired immune deficiency syndrome (AIDS). The symptoms of HIV-SN are dominated by neuropathic pain. Glia activation in the spinal cord
Praveen Thumbikat et al.
PLoS pathogens, 5(5), e1000415-e1000415 (2009-05-05)
Urinary tract infections are the second most common infectious disease in humans and are predominantly caused by uropathogenic E. coli (UPEC). A majority of UPEC isolates express the type 1 pilus adhesin, FimH, and cell culture and murine studies demonstrate
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico