Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU090231

Sigma-Aldrich

MISSION® esiRNA

targeting human REST

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCGAGTATCACTGGAGGAAACATTTAAGAAACCATTTTCCAAGGAAAGTATACACATGTGGAAAATGCAACTATTTTTCAGACAGAAAAAACAATTATGTTCAGCATGTTAGAACTCATACAGGAGAACGCCCATATAAATGTGAACTTTGTCCTTACTCAAGTTCTCAGAAGACTCATCTAACTAGACATATGCGTACTCATTCAGGTGAGAAGCCATTTAAATGTGATCAGTGCAGTTATGTGGCCTCTAATCAACATGAAGTAACCCGCCATGCAAGACAGGTTCACAATGGGCCTAAACCTCTTAATTGCCCACACTGTGATTACAAAACAGCAGATAGAAGCAACTTCAAAAAACATGTAGAGCTACATGTGAACCCACGGCAGTTCAATTGCCCTGTATGTGACTATGCAGCTTCCAAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rui Wang et al.
International journal of molecular medicine, 42(5), 2831-2838 (2018-08-23)
Type 1 diabetes involves the immunologically mediated destruction of insulin‑producing cells (IPCs) in the pancreatic islet. Mesenchymal stem cells (MSCs) have the ability to differentiate into IPCs and have become the most promising means for diabetes therapy. The present study
Gopal Pandi et al.
PloS one, 8(3), e58039-e58039 (2013-03-22)
Recent studies showed that stroke extensively alters cerebral microRNA (miRNA) expression profiles and several miRNAs play a role in mediating ischemic pathophysiology. We currently evaluated the significance of miR-29c, a highly expressed miRNA in rodent brain that was significantly down-regulated
James C Geoghegan et al.
Molecular therapy. Nucleic acids, 1, e53-e53 (2012-01-01)
Delivery of small interfering RNA (siRNA) targeted to specific cell types is a significant challenge for the development of RNA interference-based therapeutics. Recently, PTD-DRBD, a double-stranded RNA binding domain (DRBD) fused to the TAT protein transduction domain (PTD), was shown
Wai Hon Chooi et al.
Biomaterials science, 6(11), 3019-3029 (2018-10-03)
The use of human induced pluripotent stem cell-derived neural progenitor cells (hiPSC-NPCs) is an attractive therapeutic option for damaged nerve tissues. To direct neuronal differentiation of stem cells, we have previously developed an electrospun polycaprolactone nanofiber scaffold that was functionalized
Wei Wang et al.
Molecular biology of the cell, 22(6), 868-879 (2011-01-29)
Developing neurons undergo a series of maturational stages, and the timing of these events is critical for formation of synaptic circuitry. Here we addressed temporal regulation of the Gabra6 gene, which is expressed in a delayed manner during dendritogenesis in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico