Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU076051

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACAACCTCACCTTCCACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTGTTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATTCTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCCCGAAACACGACAGTGGAGTATGTGACATTCACCAGCATTGCTGGTCTCACTGGAGTGATCATGACAATAGCCTTGATTCTCATGGTAACTTCAGCTACTGAGTTCATCCGGAGGAGTTATTTTGAAGTCTTCTGGTATACTCACCACCTTTTTATCTTCTATATCCTTGGCTTAGGGATTCACGGCATTGGTGGAATTGTCCGGGGTCAAACAGAGGAGAGCATGAATGAGAGTCATCCTCGCAAGTGTG

Ensembl | human accession no.

ENSG00000007952

NCBI accession no.

NM_007052

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NOX1(27035) , NOX1(27035)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gerco den Hartog et al.
PLoS pathogens, 12(1), e1005382-e1005382 (2016-01-14)
Generation of reactive oxygen species (ROS) during infection is an immediate host defense leading to microbial killing. APE1 is a multifunctional protein induced by ROS and after induction, protects against ROS-mediated DNA damage. Rac1 and NAPDH oxidase (Nox1) are important
The nuclear receptor NOR-1 modulates redox homeostasis in human vascular smooth muscle cells.
Judith Alonso et al.
Journal of molecular and cellular cardiology, 122, 23-33 (2018-08-11)
Jin-Woo Jeong et al.
International journal of molecular sciences, 20(6) (2019-03-25)
Excessive bone resorption by osteoclasts causes bone loss-related diseases and reactive oxygen species (ROS) act as second messengers in intercellular signaling pathways during osteoclast differentiation. In this study, we explored the protective effects of fermented oyster extract (FO) against receptor
H-P Wang et al.
European review for medical and pharmacological sciences, 20(21), 4474-4481 (2016-11-23)
Reactive oxygen species (ROS) generated by endogenous metabolic enzymes are involved in a variety of pathology processes, including cancer. In particular, superoxide-generating NADPH oxidase 1 (Nox1), a member of Nox enzyme family, is highly expressed in the colon tissue and
Xiao-mei Bao et al.
Clinical and experimental pharmacology & physiology, 42(8), 865-873 (2015-06-05)
Statins have been reported to have an antioxidant effect against homocysteine (Hcy)-induced endothelial dysfunction. It is unknown whether they have the same effect against migration of vascular smooth muscle cells (VSMCs) induced by Hcy. In this study, it was investigated
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico