Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU075591

Sigma-Aldrich

MISSION® esiRNA

targeting human RAC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTGTTGTGCCGAGAACACCGAGCACTGAACTTTGCAAAGACCTTCGTCTTTGAGAAGACGGTAGCTTCTGCAGTTAGGAGGTGCAGACACTTGCTCTCCTATGTAGTTCTCAGATGCGTAAAGCAGAACAGCCTCCCGAATGAAGCGTTGCCATTGAACTCACCAGTGAGTTAGCAGCACGTGTTCCCGACATAACATTGTACTGTAATGGAGTGAGCGTAGCAGCTCAGCTCTTTGGATCAGTCTTTGTGATTTCATAGCGAGTTTTCTGACCAGCTTTTGCGGAGATTTTGAACAGAACTGCTATTTCCTCTAATGAAGAATTCTGTTTAGCTGTGGGTGTGCCGGGTGGGGTGTGTGTGATCAAAGGACAAAGACAGTATTTTGACAAAATACGAAGTGGAGATTTACACTACATTGTACAAGGAATGAAAGTGTCACGGG

Ensembl | human accession no.

ENSG00000136238

NCBI accession no.

NM_018890

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAC1(5879) , RAC1(5879)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ha Linh Vu et al.
Pigment cell & melanoma research, 28(5), 590-598 (2015-07-16)
Whole exome sequencing of cutaneous melanoma has led to the detection of P29 mutations in RAC1 in 5-9% of samples, but the role of RAC1 P29 mutations in melanoma biology remains unclear. Using reverse phase protein array analysis to examine
Karina Graber et al.
Virus research, 276, 197835-197835 (2019-12-11)
Infections with the herpes simplex virus type 1 (HSV-1) are common and widespread. Most infections remain undetected but severe forms may develop in newborns and in immunocompromised patients. Moreover, HSV-1 might be involved in the pathogenesis of atherosclerosis, which may
Anika Zilch et al.
Medical microbiology and immunology, 207(3-4), 227-242 (2018-04-28)
The human cytomegalovirus (HCMV) is a common pathogen, which causes severe or even deadly diseases in immunocompromised patients. In addition, congenital HCMV infection represents a major health concern affecting especially the lung tissue of the susceptible individuals. Antivirals are a
Hongxue Shi et al.
International journal of biological sciences, 11(7), 845-859 (2015-06-17)
Fibroblasts play a pivotal role in the process of cutaneous wound repair, whereas their migratory ability under diabetic conditions is markedly reduced. In this study, we investigated the effect of basic fibroblast growth factor (bFGF) on human dermal fibroblast migration
Cuong Thach Nguyen et al.
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico