Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU073481

Sigma-Aldrich

MISSION® esiRNA

targeting human EZH2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCATGCAACACCCAACACTTATAAGCGGAAGAACACAGAAACAGCTCTAGACAACAAACCTTGTGGACCACAGTGTTACCAGCATTTGGAGGGAGCAAAGGAGTTTGCTGCTGCTCTCACCGCTGAGCGGATAAAGACCCCACCAAAACGTCCAGGAGGCCGCAGAAGAGGACGGCTTCCCAATAACAGTAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAATCAAAGGATACAGACAGTGATAGGGAAGCAGGGACTGAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAGAAAGATGAAACTTCGAGCTCCTCTGAAGCAAATTCTCGGTGTCAAACACCAATAAAGATGAAGCCAAATATTGAACCTCCTGAGAATGTGGAGTGGAGTGGTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hailong Liu et al.
Molecular cancer research : MCR, 15(9), 1275-1286 (2017-05-26)
Medulloblastoma is the most common malignant brain tumor in children. Although accumulated research has suggested that cancer stem-like cells play a key role in medulloblastoma tumorigenesis, the specific molecular mechanism regarding proliferation remains elusive. Here, we reported more abundant expression
Junchao Xue et al.
Biochimica et biophysica acta, 1863(3), 753-763 (2017-01-08)
Circular RNAs (circRNAs), a class of noncoding RNAs generated from pre-mRNAs, participate in regulation of genes. The mechanism for regulation, however, is unknown. Here, to determine if, in human keratinocyte (HaCaT) cells, circular RNAs are involved in arsenite-induced acceleration of
Jiewei Xu et al.
Pathology, research and practice, 215(6), 152374-152374 (2019-04-07)
EZH2 is a core component of the polycomb repressive complex 2 (PRC2), which catalyzes trimethylation of histone H3 lysine 27 (H3K27me3) and promotes carcinogenesis by epigenetically silencing many tumor suppressor genes. Increased EZH2 expression is a marker of advanced and
Wei Dong et al.
American journal of physiology. Cell physiology, 317(2), C253-C261 (2019-01-17)
Myocardial ischemia-reperfusion (I/R) is a common and lethal disease that threatens people's life worldwide. The underlying mechanisms are under intensive study and yet remain unclear. Here, we explored the function of miR-322/503 in myocardial I/R injury. We used isolated rat
Jing Hu et al.
Anti-cancer drugs, 30(7), e0746-e0746 (2019-07-16)
Enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) is the core component of polycomb repressive complex 2 and is overexpressed in several types of solid malignancies. It has been reported that EZH2 contributes to sorafenib resistance of hepatocellular

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico