Saltar al contenido
Merck

EHU017631

Sigma-Aldrich

MISSION® esiRNA

targeting human STK25

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGGGCATCGATAACCACACAAAGGAGGTGGTGGCCATCAAGATCATCGACCTGGAGGAGGCCGAGGATGAGATCGAGGACATCCAGCAGGAGATCACTGTCCTCAGTCAGTGCGACAGCCCCTACATCACCCGCTACTTTGGCTCCTACCTAAAGAGCACCAAGCTATGGATCATCATGGAGTACCTGGGCGGCGGCTCAGCACTGGACTTGCTTAAACCAGGTCCCCTGGAGGAGACATACATTGCCACGATCCTGCGGGAGATTCTGAAGGGCCTGGATTATCTGCACTCCGAACGCAAGATCCACCGAGACATCAAAGCTGCCAACGTGCTACTCTCGGAGCAGGGTGACGTGAAGCTGGCGGACTTTGGGGTAGCAGGGCAGCTCACAGACACGCAGATTAAGAGGAACACATTCGTGGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Emmelie Cansby et al.
JCI insight, 5(24) (2020-11-11)
Diabetic kidney disease (DKD) is the most common cause of severe renal disease worldwide and the single strongest predictor of mortality in diabetes patients. Kidney steatosis has emerged as a critical trigger in the pathogenesis of DKD; however, the molecular
Annika Nerstedt et al.
Journal of lipid research, 61(2), 178-191 (2019-12-21)
Nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) are emerging as leading causes of liver disease worldwide and have been recognized as one of the major unmet medical needs of the 21st century. Our recent translational studies in mouse

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico