Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU015561

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAU

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGGTGGAAAACCTCATCCTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCCTTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACCATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGCTTTGGAAAAGAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGAAGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTGTGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTCGTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGG

Ensembl | human accession no.

ENSG00000122861

NCBI accession no.

NM_002658

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PLAU(5328) , PLAU(5328)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Peng Liu et al.
Scientific reports, 6, 37606-37606 (2016-11-22)
Pancreatic cancer is a highly metastatic and chemo-resistant disease. Secreted proteins involved in cell-cell interactions play an important role in changing the tumor microenvironment. Previous studies generally focus on the secretome of cancer cell line from serum-free media, due to
Xin Zhao et al.
European journal of pharmacology, 880, 173225-173225 (2020-05-29)
Tripterygium wilfordii Hook F (TwHF) exhibits anti-tumor efficacy in pancreatic ductal adenocarcinoma (PDAC), however the pharmacological mechanisms are unclear due to complicated formulae and target genes. Using Traditional Chinese Medicine Systems Pharmacology and GeneCards databases, we performed a network pharmacology
Anuradha Moirangthem et al.
Scientific reports, 6, 21903-21903 (2016-02-26)
In cancer progression, proteolytic enzymes like serine proteases and metalloproteinases degrade the basement membrane enabling the tumor cells to invade the adjacent tissues. Thus, invasion and metastasis are augmented by these enzymes. Simultaneous silencing of uPA and MMP9 in breast
Ko-Hsiu Lu et al.
Molecules (Basel, Switzerland), 26(1) (2020-12-31)
Osteosarcoma, the most prevalent malignant bone tumor in the pediatric age group, is responsible for the great majority of cancer-associated deaths owing to its highly metastatic potential. The anti-metastatic effects of the new curcumin analogue L48H37 in human osteosarcoma are
Hai Li et al.
Integrative cancer therapies, 17(2), 511-523 (2017-06-20)
Gastric cancer (GC) is a malignancy with few effective treatment options after metastasis occurs. Quercetin (Qu) intake has been associated with reduced incidence and slow development of GC, probably due to its anti-proliferative and apoptotic effects, but it is unclear
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico