Skip to Content
Merck
All Photos(1)

Documents

EMU031541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pmaip1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACTCCGGAGGATTGGAGACAAAGTGAATTTACGGCAGAAACTTCTGAATTTGATTTCCAAGCTCTTCAATTTAGTAACCTGAGTTCTTCCAAAGCTTTTGCAAGAAGGGACCTCCCAGGAAGGAAGTTCCGCCGGTTGATGGAAATGCCTGGTATTGGATGGATTGTGATGTGATGAGAGAAACGCTCGCTTGCTTTTGGTTCCCTGAGCAGGGATGATGAAGGAGATAGGAATGAGTTTCTTTCGGAAAGTTTTCAGAAATCGTTCTTTGAGCTGTGATAACGTGAAACCACACTTGTTTTTACTTTTATTATTATTTTTTTGAAGAGTCGTGGAGCTAGGGAAGTAACTAGTAATAATCTATCTTTTTAGAGTTGTTCTGGTTGTTTTTGCCAAAGGTTGTTGTCAAGAATAATAGACGGGGTATGGCTAGTGGTTACATTGTATGGGGGCAGTCGTTTGGGATTGCTTT

Ensembl | mouse accession no.

ENSMUSG00000024521

NCBI accession no.

NM_021451

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... PMAIP1(58801) , Pmaip1(58801)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wei Qian et al.
Oncotarget, 5(12), 4180-4194 (2014-06-24)
Overcoming platinum drug resistance represents a major clinical challenge in cancer treatment. We discovered a novel drug combination using cisplatin and a class of thioquinazolinone derivatives including mdivi-1 (mitochondrial division inhibitor-1), that induces synergistic apoptosis in platinum resistant tumor cells
Georg Karpel-Massler et al.
Oncotarget, 6(34), 36456-36471 (2015-10-17)
Glioblastoma is the most frequent primary brain tumor in adults. Current therapeutic options are sparse and the prognosis of patients suffering from this disease is grim. Abundance in intratumoral heterogeneity among different deregulated signaling pathways is a hallmark of glioblastoma
Xiao-Lan Li et al.
Oncotarget, 6(34), 36689-36699 (2015-10-10)
PRIMA-1met (APR-246) is a methylated derivative and structural analog of PRIMA-1 (p53 re-activation and induction of massive apoptosis). PRIMA-1met has been reported to restore both the wild type (wt) structure and function of mutant p53. Here, we show that PRIMA-1met
Haichao Zhang et al.
Molecular cancer, 14, 126-126 (2015-07-03)
Defects in programmed cell death, or apoptosis, are a hallmark of cancer. The anti-apoptotic B-cell lymphoma 2 (BCL-2) family proteins, including BCL-2, BCL-X(L), and MCL-1 have been characterized as key survival factors in multiple cancer types. Because cancer types with
Florian Engert et al.
Molecular cancer therapeutics, 14(12), 2818-2830 (2015-10-07)
Ewing sarcoma has recently been reported to be sensitive to poly(ADP)-ribose polymerase (PARP) inhibitors. Searching for synergistic drug combinations, we tested several PARP inhibitors (talazoparib, niraparib, olaparib, veliparib) together with chemotherapeutics. Here, we report that PARP inhibitors synergize with temozolomide

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service