Skip to Content
Merck
All Photos(1)

Key Documents

EHU091471

Sigma-Aldrich

MISSION® esiRNA

targeting human CPEB4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCATTCCTGCTGTTTCAAGATGAAAGCTCTGTGCAGGCTCTCATTGATGCATGCATTGAAGAAGATGGAAAACTCTACCTTTGTGTATCAAGTCCCACTATCAAGGATAAGCCAGTCCAGATTCGGCCTTGGAATCTCAGTGACAGTGACTTTGTGATGGATGGTTCACAGCCACTTGACCCACGAAAAACTATATTTGTTGGTGGTGTTCCTCGACCATTACGAGCTGTGGAGCTTGCGATGATAATGGATCGGCTATATGGAGGTGTGTGCTACGCTGGGATTGATACCGACCCTGAGCTAAAATACCCAAAAGGAGCTGGGAGAGTTGCGTTCTCTAATCAACAGAGTTACATAGCTGCTATCAGTGCCCGCTTTGTTCAGCTGCAGCATGGAGAGATAGATAAACGGGTGGAAGTTAAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Valeria Giangarrà et al.
PloS one, 10(9), e0138794-e0138794 (2015-09-24)
CPEB (Cytoplasmic Polyadenylation Element Binding) proteins are a family of four RNA-binding proteins that regulate the translation of maternal mRNAs controlling meiotic cell cycle progression. But CPEBs are not limited to the transcriptionally silent germline; they are also expressed, in
Eva Pérez-Guijarro et al.
Nature communications, 7, 13418-13418 (2016-11-20)
Nuclear 3'-end-polyadenylation is essential for the transport, stability and translation of virtually all eukaryotic mRNAs. Poly(A) tail extension can also occur in the cytoplasm, but the transcripts involved are incompletely understood, particularly in cancer. Here we identify a lineage-specific requirement
Weihua Huang et al.
Diagnostic pathology, 10, 127-127 (2015-07-26)
The microRNAs present a class of non-coding RNAs which are usually implicated in tumor biology. Recent report has unraveled that a novel member of microRNA family called miR-1246. However, the functional role and molecular mechanisms of miR-1246 in non-small cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service