Skip to Content
Merck
All Photos(1)

Documents

EMU021131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Notch4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGAAGGAAGCGACACGTACGAGTCTGGAAGACTCCGGACTTTTAAGGCCAAAATAACCGTTAAGCTCACTTGTCTCCCCCATAGAGTATGCACAGCAATGGGAAGAGGGTTTAGGATGTCCGGTTGAGATAGACCGTGATTTTCCTGGAAAATAGGGCAGCTTCAAGAGGACAAAGTTGATTTCGAGAATCCCTAAACTCTGGAACCAAGAACTGTGGGCGAATTGGGTGTAAAATGTTTCTTGAGTATGGTTTCCCAAAAGGAGCCTCTGCTATCTACTGCCCACAAGTAGCTGGCAACTATTTATTAAGCACCTACGATGTGCCGGGTGTTGTGTAGATGATGAACAGTAACCAGTGGCCCATCCAGCTGATGACTCCTTGCCCTCTCTCTGCCTCCCCACAAGGACACTGGTGCAGGGATGAGGCCATGTTCTCCAGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Quyen Thu Bui et al.
Cancer letters, 390, 115-125 (2017-01-22)
We previously demonstrated that tamoxifen (TAM)-resistant human breast cancer (TAMR-MCF-7) cells showed increased expression of mesenchymal marker proteins compared to the parent MCF-7 cells. Notch is functionally important in the promotion of epithelial-mesenchymal transition (EMT) during both development and tumor
Cui-Juan Qian et al.
Oncology letters, 12(5), 3499-3505 (2016-12-03)
Overexpression of Notch4 is associated with a variety of tumor types. Only sparse information exists on Notch4 expression in pancreatic cancer (PC). The present study demonstrated that Notch4 expression was significantly upregulated in PC cell lines compared with a non-transformed
Hebah A Sindi et al.
Nature communications, 11(1), 1185-1185 (2020-03-07)
Pulmonary arterial hypertension (PAH) is a severe disorder of lung vasculature that causes right heart failure. Homoeostatic effects of flow-activated transcription factor Krüppel-like factor 2 (KLF2) are compromised in PAH. Here, we show that KLF2-induced exosomal microRNAs, miR-181a-5p and miR-324-5p

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service