Skip to Content
Merck
All Photos(1)

Key Documents

EHU143531

Sigma-Aldrich

MISSION® esiRNA

targeting human SRGN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCACCCTGCTACATTTCCTAATCAAGAAGTTGGCGTGCAGCTGGGAGAGCTAGACTAAGTTGGTCATGATGCAGAAGCTACTCAAATGCAGTCGGCTTGTCCTGGCTCTTGCCCTCATCCTGGTTCTGGAATCCTCAGTTCAAGGTTATCCTACGCGGAGAGCCAGGTACCAATGGGTGCGCTGCAATCCAGACAGTAATTCTGCAAACTGCCTTGAAGAAAAAGGACCAATGTTCGAACTACTTCCAGGTGAATCCAACAAGATCCCCCGTCTGAGGACTGACCTTTTTCCAAAGACGAGAATCCAGGACTTGAATCGTATCTTCCCACTTTCTGAGGACTACTCTGGATCAGGCTTCGGCTCCGGCTCCGGCTCTGGATCAGGATCTGGGAGTGGCTTCCTAACGGAAATGGAACAGGATTACCAACTAGTAGACGAAAGTGATGCTTTCCATGACAACCTTAGGTCTCTTGACAGGAATCTGCCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qinfeng Ma et al.
Molecular and cellular biochemistry, 474(1-2), 15-26 (2020-07-28)
Endothelial cells (ECs) play an important role in the pathogenesis of cardiovascular disease, especially atherosclerosis (AS). The abnormal wall shear stress (WSS) which directly contacts with ECs is the key stimulating factor leading to AS. However, the underlying mechanism of
Angela D'Ascola et al.
Biochemical and biophysical research communications, 499(3), 506-512 (2018-03-29)
Serglycin is expressed by a variety of cell types and mediates different functions in both normal and pathological conditions by interacting with different biological molecules, such as the CD44 receptor. Many studies suggest that serglycin has a crucial role in
Michele Scuruchi et al.
Archives of biochemistry and biophysics, 669, 80-86 (2019-05-31)
Serglycin (SRGN) is an intracellular proteoglycan produced and secreted by several cell types. The increased expression of SRGN was associated with greater aggressiveness in cancer and inflammation. In this study, we demonstrated that SRGN is increased in human chondrocytes after

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service