Skip to Content
Merck
All Photos(1)

Documents

EHU068841

Sigma-Aldrich

MISSION® esiRNA

targeting human AMFR

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCTTTCTGTCCCACTACATCTGGGACTGACTTTCCGAGCCTCCAGTCCAAAGCCGGCTTGATTTCCGTGAACTCTGGTGCTCCTGCATCTCATGAGTGTGCCCCATGGGTCCCCTCCCCTCTCAGCATTTCCTTGTCCCGTCTGGACCTGGGGAGTGGTTAGGCAGCAAGCTTTGGTTTATGGTTTTCATTCATTGGTGAAGTAAATTAGGCAGTGCTAAAGCCTGTGGGTTTGGTCCTTGAACAAGATGTGGGCCTTGCAAGATGGGAGAGTAAACCTTGAAGGGCTTTATTAAAGAAATAAAAAAGAACTTTTGTATCTTTTATCCTGGGAGCACTGCGTTTTCCTAGCTGTGTTATTCCTGGTTTAATTCAGCAGAGAAGGTAAGGTGTGAACCTACCTGCCTTGGA

Ensembl | human accession no.

ENSG00000159461

NCBI accession no.

NM_001144

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AMFR(267) , AMFR(267)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Youngah Jo et al.
Molecular biology of the cell, 24(3), 169-183 (2012-12-12)
Sterol-induced binding to Insigs in endoplasmic reticulum (ER) membranes triggers ubiquitination of the cholesterol biosynthetic enzyme 3-hydroxy-3-methylglutaryl CoA reductase. This ubiquitination, which is mediated by Insig-associated ubiquitin ligases gp78 and Trc8, is obligatory for extraction of reductase from lipid droplet-associated
Ming Zong et al.
Arthritis research & therapy, 17, 100-100 (2015-04-19)
Fibroblast-like synoviocytes (FLS) play an important role in the pathogenesis of rheumatoid arthritis (RA). This study aimed to investigate the role of glucose 6-phosphate isomerase (GPI) in the proliferation of RA-FLS. The distribution of GPI in synovial tissues from RA
Jin Chai et al.
Journal of hepatology, 63(6), 1440-1448 (2015-07-28)
Multidrug resistance-associated protein 2 (MRP2) excretes conjugated organic anions including bilirubin and bile acids. Malfunction of MRP2 leads to jaundice in patients. Studies in rodents indicate that Radixin plays a critical role in determining Mrp2 canalicular membrane expression. However, it
Kerrie L Marie et al.
Nature communications, 11(1), 333-333 (2020-01-18)
Cutaneous malignant melanoma is an aggressive cancer of melanocytes with a strong propensity to metastasize. We posit that melanoma cells acquire metastatic capability by adopting an embryonic-like phenotype, and that a lineage approach would uncover metastatic melanoma biology. Using a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service