Skip to Content
Merck
All Photos(1)

Key Documents

EHU049781

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX5

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGTCGAGGAGTGTGACAATGAGAAAGAGTCAAAGGTCGTCCAAGGGCTCTGAGATACTTTTGGAGAAACACAAATTCTGTAACATCAAGTGCTACATCGATGGGCCTTATGGGACCCCCACCCGCAGGATCTTTGCCTCTGAGCATGCCGTGCTCATCGGGGCAGGCATCGGCATCACCCCCTTTGCTTCCATTCTGCAGAGTATCATGTACAGGCACCAGAAAAGAAAGCATACTTGCCCCAGCTGCCAGCACTCCTGGATCGAAGGTGTCCAAGACAACATGAAGCTCCATAAGGTGGACTTTATCTGGATCAACAGAGACCAGCGGTCTTTCGAGTGGTTTGTGAGCCTGCTGACTAAACTGGAGATGGACCAGGCCGAGGAGGCTCAATACGGCCGCTTCCTGGAGCTGCATATGTACATGACATCTGCACTGGGCAAGAATGACATG

Ensembl | human accession no.

ENSG00000137808

NCBI accession no.

NM_024505

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NOX5(79400) , NOX5(79400)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dan Li et al.
The Journal of pharmacology and experimental therapeutics, 360(1), 14-22 (2016-10-21)
We have shown that NADPH oxidase (NOX)5-S may mediate the acid-induced decrease in cell apoptosis. However, mechanisms of NOX5-S-dependent decrease in cell apoptosis are not fully understood. In this study, we found that silencer-of-death domain (SODD) was significantly increased in
Farhan Rizvi et al.
PloS one, 7(4), e34440-e34440 (2012-04-19)
To determine whether NOX 5 is expressed in rabbit corneal stromal cells (RCSC). NADPH oxidases (NOXes) are enzymes that preferentially use NADPH as a substrate and generate superoxide. Several isoforms of NOXes function as multi-protein complexes while NOX5 and DUOXs
Jie Chen et al.
Signal transduction and targeted therapy, 5(1), 139-139 (2020-08-15)
Reactive oxygen species (ROS) localized at the precise subcellular compartments are essential for regulating the activity of signaling proteins. Furthermore, ROS are master regulators of tumor malignant progression that respond to a diverse set of environmental stress, especially hypoxia. NADPH
Hope K A Gole et al.
PloS one, 9(8), e105337-e105337 (2014-08-22)
NADPH oxidase (NOX) is the primary source of reactive oxygen species (ROS) in vascular smooth muscle cells (SMC) and is proposed to play a key role in redox signaling involved in the pathogenesis of cardiovascular disease. Growth factors and cytokines
S Carnesecchi et al.
Free radical biology & medicine, 84, 22-29 (2015-03-24)
Reactive oxygen species (ROS) are key modulators of apoptosis and carcinogenesis. One of the important sources of ROS is NADPH oxidases (NOXs). The isoform NOX5 is highly expressed in lymphoid tissues, but it has not been detected in any common

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service