Skip to Content
Merck
All Photos(1)

Documents

EHU023141

Sigma-Aldrich

MISSION® esiRNA

targeting human XPA

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCGAAGAATGTGGGAAAGAATTTATGGATTCTTATCTTATGAACCACTTTGATTTGCCAACTTGTGATAACTGCAGAGATGCTGATGATAAACACAAGCTTATAACCAAAACAGAGGCAAAACAAGAATATCTTCTGAAAGACTGTGATTTAGAAAAAAGAGAGCCACCTCTTAAATTTATTGTGAAGAAGAATCCACATCATTCACAATGGGGTGATATGAAACTCTACTTAAAGTTACAGATTGTGAAGAGGTCTCTTGAAGTTTGGGGTAGTCAAGAAGCATTAGAAGAAGCAAAGGAAGTCCGACAGGAAAACCGAGAAAAAATGAAACAGAAGAAATTTGATAAAAAAGTAAAAGAATTGCGGCGAGCAGTAAGAAGCAGCGTGTGGAAAAGGGAGACGATTGTTCATCAACATGAGTATGGACCAGAAGAAAACCTAGAAGATGACATGTACCGTAAGACTTGTACTATGTGTGGCCATGAACTGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Yi Wen Kong et al.
Nature communications, 11(1), 4124-4124 (2020-08-19)
In response to DNA damage, a synthetic lethal relationship exists between the cell cycle checkpoint kinase MK2 and the tumor suppressor p53. Here, we describe the concept of augmented synthetic lethality (ASL): depletion of a third gene product enhances a
Mariangela Sabatella et al.
Cellular and molecular life sciences : CMLS, 77(10), 2005-2016 (2019-08-09)
The effectiveness of many DNA-damaging chemotherapeutic drugs depends on their ability to form monoadducts, intrastrand crosslinks and/or interstrand crosslinks (ICLs) that interfere with transcription and replication. The ERCC1-XPF endonuclease plays a critical role in removal of these lesions by incising

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service