Skip to Content
Merck
All Photos(1)

Documents

EMU054571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rrm1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCCTGAATTCTGCCATTATCTATGACCGAGATTTCTCTTATAACTACTTTGGCTTTAAGACACTGGAACGGTCATATTTGTTGAAGATCAATGGTAAAGTGGCTGAAAGACCACAGCATATGTTGATGAGGGTTTCTGTGGGGATTCACAAAGAAGATATTGATGCTGCAATTGAAACCTACAACCTACTTTCTGAGAAGTGGTTCACTCATGCCTCTCCTACTCTCTTCAATGCTGGGACCAACCGCCCACAGCTGTCTAGCTGTTTCCTCTTGAGTATGAAAGATGACAGCATTGAAGGAATTTATGATACTCTGAAGCAGTGTGCCTTGATTTCTAAGTCCGCTGGGGGAATTGGTGTTGCTGTGAGTTGTATTCGGGCCACTGGTAGCTACATCGCTGGGACTAATGGCAATTCTAATGGCCTTGTGCCAATGCTGAGAGTATATAACAACACAGCTCGCTATGTGGATCAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jianmei Wu et al.
Journal of chromatography. B, Analytical technologies in the biomedical and life sciences, 1006, 167-178 (2015-11-10)
Simultaneous, quantitative determination of intracellular nucleoside triphosphates and other polar metabolites using liquid chromatography with electrospray ionization tandem mass spectrometry (LC-MS/MS) represents a bioanalytic challenge because of charged, highly hydrophilic analytes presented at a large concentration range in a complex
Rong Yao et al.
PloS one, 10(5), e0125169-e0125169 (2015-05-07)
Pulmonary fibrosis is one of the most common complications of paraquat (PQ) poisoning, which demands for more effective therapies. Accumulating evidence suggests adiponectin (APN) may be a promising therapy against fibrotic diseases. In the current study, we determine whether the
Chou-Kit Chou et al.
International journal of molecular sciences, 16(7), 15104-15117 (2015-07-08)
BubR1 is a critical component of spindle assembly checkpoint, ensuring proper chromatin segregation during mitosis. Recent studies showed that BubR1 was overexpressed in many cancer cells, including oral squamous cell carcinomas (OSCC). However, the effect of BubR1 on metastasis of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service