Skip to Content
Merck
All Photos(1)

Key Documents

EMU000411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sirt1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAAGCGGCTTGAGGGTAATCAATACCTGTTTGTACCACCAAATCGTTACATATTCCACGGTGCTGAGGTATACTCAGACTCTGAAGATGACGTCTTGTCCTCTAGTTCCTGTGGCAGTAACAGTGACAGTGGCACATGCCAGAGTCCAAGTTTAGAAGAACCCTTGGAAGATGAAAGTGAAATTGAAGAATTCTACAATGGCTTGGAAGATGATACGGAGAGGCCCGAATGTGCTGGAGGATCTGGATTTGGAGCTGATGGAGGGGATCAAGAGGTTGTTAATGAAGCTATAGCTACAAGACAGGAATTGACAGATGTAAACTATCCATCAGACAAATCATAACACTATTGAAGCTGTCCGGATTCAGGAATTGCTCCACCAGCATTGGGAACTTTAGCA

Ensembl | mouse accession no.

ENSMUSG00000020063

NCBI accession no.

NP_062786

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... SIRT1(93759) , Sirt1(93759)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
WPT
YHT
MGT
VAT
IBS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mickaël Ohanna et al.
Oncotarget, 5(8), 2085-2095 (2014-04-20)
SIRT1 operates as both a tumor suppressor and oncogenic factor depending on the cell context. Whether SIRT1 plays a role in melanoma biology remained poorly elucidated. Here, we demonstrate that SIRT1 is a critical regulator of melanoma cell proliferation. SIRT1
Xiwen Xiong et al.
PloS one, 14(2), e0212523-e0212523 (2019-02-23)
Nicotinamide phosphoribosyltransferase (NAMPT) is a rate-limiting enzyme in mammalian nicotinamide adenine dinucleotide (NAD)+ biosynthesis. Through its NAD+-biosynthetic activity, NAMPT influences the activity of NAD+-dependent enzymes, such as sirtuins. NAMPT is able to modulate processes involved in the pathogenesis of non-alcohol
Jie-Ning Zhu et al.
Scientific reports, 7(1), 11879-11879 (2017-09-21)
The molecular mechanisms underlying anthracyclines-induced cardiotoxicity have not been well elucidated. MiRNAs were revealed dysregulated in the myocardium and plasma of rats received Dox treatment. MicroRNA-34a-5p (miR-34a-5p) was verified increased in the myocardium and plasma of Dox-treated rats, but was
Yi Fu et al.
Cell metabolism, 32(6), 1052-1062 (2020-11-14)
Lipid accumulation in podocytes is a major determinant of diabetic kidney disease (DKD) and identification of potential therapeutic targets by mediating podocyte lipid metabolism has clinical importance. This study was to elucidate the role of JAML (junctional adhesion molecule-like protein)
Huiwen Ren et al.
Frontiers in molecular biosciences, 7, 137-137 (2020-08-06)
Aims: To investigate the role of Vasohibin-1 (VASH-1), silence information adjustment factor 2-related enzyme 1 (SIRT1)/hypoxic-inducible factor 1α (HIF1α) and transforming growth factor-β1 (TGFβ1) /Smad3 signaling pathways in oxidative stress and fibrosis of diabetic kidney disease (DKD). Materials and Methods:
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service