Skip to Content
Merck
All Photos(1)

Documents

EHU097711

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARG

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTAGCAGAGAGTCCTGAGCCACTGCCAACATTTCCCTTCTTCCA

Ensembl | human accession no.

ENSG00000132170

NCBI accession no.

NM_015869

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PPARG(5468) , PPARG(5468)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pradip K Saha et al.
American journal of physiology. Endocrinology and metabolism, 319(4), E667-E677 (2020-08-18)
MicroRNA-30a (miR-30a) impacts adipocyte function, and its expression in white adipose tissue (WAT) correlates with insulin sensitivity in obesity. Bioinformatic analysis demonstrates that miR-30a expression contributes to 2% of all miRNA expression in human tissues. However, molecular mechanisms of miR-30a
Vahid Kheirollahi et al.
Nature communications, 10(1), 2987-2987 (2019-07-07)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease in which the intricate alveolar network of the lung is progressively replaced by fibrotic scars. Myofibroblasts are the effector cells that excessively deposit extracellular matrix proteins thus compromising lung structure and function.
Wenxin Hu et al.
Environmental science & technology, 51(7), 4061-4068 (2017-03-11)
2-Ethylhexyl diphenyl phosphate (EHDPP), an organophosphate flame retardant (OPFR), is frequently detected in human blood. In this study, the sensitive dual-luciferase reporter gene assay and molecular docking were used to investigate the activation of EHDPP to human peroxisome proliferator-activated receptor
Miao Xu et al.
Oncotarget, 8(56), 95914-95930 (2017-12-10)
The poor prognosis of esophageal squamous cell carcinoma (ESCC) emphasizes the urgent need to better understand the carcinogenesis and develop prevention strategies. Previous studies have highlighted the potential of using Vitamin E (tocopherols) for cancer chemoprevention, but the preventive activity

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service