Skip to Content
Merck
All Photos(1)

Key Documents

EHU070441

Sigma-Aldrich

MISSION® esiRNA

targeting human NFIB

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAAGATATTCGCCAGGAGTATCGAGAGGACTTTGTGCTCACCGTGACTGGCAAGAAGCACCCGTGCTGTGTCTTATCCAATCCCGACCAGAAGGGTAAGATTAGGAGAATCGACTGCCTGCGACAGGCAGACAAAGTCTGGCGTCTGGATCTAGTCATGGTGATCCTGTTCAAAGGCATCCCCTTGGAAAGTACCGATGGAGAGCGGCTCATGAAATCCCCACATTGCACAAACCCAGCACTTTGTGTCCAGCCACATCATATCACAGTATCAGTTAAGGAGCTTGATTTGTTTTTGGCATACTACGTGCAGGAGCAAGATTCTGGACAATCAGGAAGTCCAAGCCACAATGATCCTGCCAAGAATCCTCCAGGTTACCTTGAGGATAGTTTTGTAAAATCTGGAGTCTTCAATGTATCAGAACTTGTAAGAGTATCCAGAACGCCCATAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Q-Y Liu et al.
European review for medical and pharmacological sciences, 24(13), 7266-7275 (2020-07-25)
Long non-coding RNAs (lncRNAs) have been found to exert specific functions in the progression of ovarian cancer (OC), except for lncRNA-OIP5-AS1. In this study, we aim at exploring the molecular mechanisms of OIP5-AS1 in OC. The expression levels of OIP5-AS1
Jing Chen et al.
Viruses, 7(10), 5539-5552 (2015-10-30)
Porcine reproductive and respiratory syndrome virus (PRRSV) infection strongly modulates the host's immune response. The RNA silencing pathway is an intracellular innate response to viral infections. However, it is unknown whether PRRSV interacts with cellular RNA silencing to facilitate the
Anna Yu-Szu Huang et al.
Neuron, 106(6), 992-1008 (2020-04-23)
Astrocytes play essential roles in brain function by supporting synaptic connectivity and associated circuits. How these roles are regulated by transcription factors is unknown. Moreover, there is emerging evidence that astrocytes exhibit regional heterogeneity, and the mechanisms controlling this diversity

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service