Skip to Content
Merck
All Photos(1)

Key Documents

EHU036561

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF20

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAATGGCTGATGAGGATGCCTTGAGGAAGATCCGGGCAGTGGAGGAGCAGATAGAATACCTACAGAAGAAGCTAGCCATGGCCAAGCAGGAAGAAGAAGCACTCCTCTCTGAAATGGATGTCACAGGCCAGGCCTTTGAAGACATGCAGGAGCAAAATATCCGTTTGATGCAGCAATTGCGGGAGAAGGATGATGCAAATTTCAAGCTCATGTCAGAGCGTATCAAGTCCAATCAGATCCATAAGTTGCTTAAAGAAGAGAAGGAGGAGCTGGCAGACCAGGTGTTGACTCTGAAGACTCAGGTTGATGCCCAGCTACAGGTAGTAAGGAAACTGGAAGAGAAGGAGCATCTGTTACAGAGCAACATTGGCACAGGGGAGAAAGAGCTGGGTCTTAGGACCCAAGCCTTAGAGATGAATAAACGCAAGGCAATGGAGGCAGCCCAGCTTGCAGATGACCTCAAAGCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jagmohan Hooda et al.
Cancer research, 79(4), 760-772 (2018-12-20)
Recent insights supporting the fallopian tube epithelium (FTE) and serous tubal intraepithelial carcinomas (STIC) as the tissue of origin and the precursor lesion, respectively, for the majority of high-grade serous ovarian carcinomas (HGSOC) provide the necessary context to study the
Danping Wang et al.
Frontiers in oncology, 10, 613470-613470 (2020-12-29)
E-cadherin, a hallmark of epithelial-mesenchymal transition (EMT), is often repressed due to Snail-mediated epigenetic modification; however, the exact mechanism remains unclear. There is an urgent need to understand the determinants of tumor aggressiveness and identify potential therapeutic targets in breast
Z-X Wang et al.
European review for medical and pharmacological sciences, 24(19), 9981-9989 (2020-10-23)
To explore the clinical significance of circRNF20 in non-small-cell lung carcinoma (NSCLC), and its regulatory effects on NSCLC cell functions by activating MAPK9. Relative levels of circRNF20 and MAPK9 in NSCLC tissues were detected by quantitative Real Time-Polymerase Chain Reaction

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service