Skip to Content
Merck
All Photos(1)

Key Documents

EHU026451

Sigma-Aldrich

MISSION® esiRNA

targeting human ORMDL3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGCATCTGGCTCTCCTACGTGCTGGCCATCGGTCTCCTCCACATCGTGCTGCTGAGCATCCCGTTTGTGAGTGTCCCTGTCGTCTGGACCCTCACCAACCTCATTCACAACATGGGCATGTATATCTTCCTGCACACGGTGAAGGGGACACCCTTTGAGACCCCGGACCAGGGCAAGGCGAGGCTGCTAACCCACTGGGAGCAGATGGATTATGGGGTCCAGTTCACGGCCTCTCGGAAGTTCTTGACCATCACACCCATCGTGCTGTACTTCCTCACCAGCTTCTACACTAAGTACGACCAGATCCATTTTGTGCTCAACACCGTGTCCCTGATGAGCGTGCTTATCCCCAAGCTGCCCCAGCTCCACGGAGTCCGGATTTTTGGAATCAATAAGTACTGAGAGTGCAGCCCCTT

Ensembl | human accession no.

ENSG00000172057

NCBI accession no.

NM_139280

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ORMDL3(94103) , ORMDL3(94103)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weixia Yang et al.
Aging, 11(9), 2787-2796 (2019-05-08)
Endoplasmic reticulum (ER) stress in beta cells induces a signaling network called the unfolded protein response (UPR), which plays a dual role in diabetes. A key regulator of ER-stress and UPR, the orosomucoid 1-like protein 3 (ORMDL3), has been shown
Youming Zhang et al.
American journal of respiratory and critical care medicine, 199(4), 478-488 (2018-10-20)
Polymorphisms on chromosome 17q21 confer the major genetic susceptibility to childhood-onset asthma. Risk alleles positively correlate with ORMDL3 (orosomucoid-like 3) expression. The locus influences disease severity and the frequency of human rhinovirus (HRV)-initiated exacerbations. ORMDL3 is known to regulate sphingolipid
Yiping Liu et al.
American journal of respiratory cell and molecular biology, 62(6), 783-792 (2020-02-23)
Polymorphism at the 17q21 gene locus and wheezing responses to rhinovirus (RV) early in childhood conspire to increase the risk of developing asthma. However, the mechanisms mediating this gene-environment interaction remain unclear. In this study, we investigated the impact of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service