Skip to Content
Merck
All Photos(1)

Documents

EHU012511

Sigma-Aldrich

MISSION® esiRNA

targeting human ST14

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGTCCTGCTCATCACACTGATAACCAACACTGAGCGGCGGCATCCCGGCTTTGAGGCCACCTTCTTCCAGCTGCCTAGGATGAGCAGCTGTGGAGGCCGCTTACGTAAAGCCCAGGGGACATTCAACAGCCCCTACTACCCAGGCCACTACCCACCCAACATTGACTGCACATGGAACATTGAGGTGCCCAACAACCAGCATGTGAAGGTGCGCTTCAAATTCTTCTACCTGCTGGAGCCCGGCGTGCCTGCGGGCACCTGCCCCAAGGACTACGTGGAGATCAACGGGGAGAAATACTGCGGAGAGAGGTCCCAGTTCGTCGTCACCAGCAACAGCAACAAGATCACAGTTCGCTTCCACTCAGATCAGTCCTACACCGACACCGGCTTCTTAGCTGAATACCTCTCCTACGACTCCAGTGACCCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chuan-Jin Wu et al.
The Journal of clinical investigation, 127(2), 623-634 (2017-01-18)
Congenital tufting enteropathy (CTE) is a severe autosomal recessive human diarrheal disorder with characteristic intestinal epithelial dysplasia. CTE can be caused by mutations in genes encoding EpCAM, a putative adhesion molecule, and HAI-2, a cell surface protease inhibitor. A similar
Chuan-Jin Wu et al.
Cells, 9(4) (2020-04-25)
The homologs EpCAM and TROP2, which both interact with claudin-1 and claudin-7, are frequently coexpressed in epithelia including skin. Intestine uniquely expresses high levels of EpCAM but not TROP2. We previously identified EpCAM as a substrate of the membrane-anchored protease
Makiko Kawaguchi et al.
The American journal of pathology, 185(6), 1610-1623 (2015-04-07)
Hepatocyte growth factor activator inhibitor type 1 (HAI-1; official symbol SPINT1) is a membrane-associated serine proteinase inhibitor abundantly expressed in epithelial tissues. Genetically engineered mouse models demonstrated that HAI-1 is critical for epidermal function, possibly through direct and indirect regulation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service