Skip to Content
Merck
All Photos(1)

Key Documents

EHU010121

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGTTTTCATGACCTCCTGTCACAGCTGGATGATCAATATAGTCGCTTTTCTTTGGAGAATAACTTCTTGCTACAGCATAACATAAGGAAAAGCAAGCGTAATCTTCAGGATAATTTTCAGGAAGACCCAATCCAGATGTCTATGATCATTTACAGCTGTCTGAAGGAAGAAAGGAAAATTCTGGAAAACGCCCAGAGATTTAATCAGGCTCAGTCGGGGAATATTCAGAGCACAGTGATGTTAGACAAACAGAAAGAGCTTGACAGTAAAGTCAGAAATGTGAAGGACAAGGTTATGTGTATAGAGCATGAAATCAAGAGCCTGGAAGATTTACAAGATGAATATGACTTCAAATGCAAAACCTTGCAGAACAGAGAACACGAGACCAATGGTGTGGCAAAGAGTGATCAGAAACAAGAACAGCTGTTACTCAAGAAGATGTATTTAATGCTTGACAATAAGAGAAAGGAAGTAGTTCACAAAATAATAGAGTTGCTGAATGTCACTGAACTTACCCAGAATGCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sophia Hatziieremia et al.
Molecular carcinogenesis, 55(11), 1667-1677 (2015-10-27)
STAT1 loss has previously been implicated in cell line studies to modify prostate cancer cell growth and survival, however the clinical significance of this has not previously been established. This study investigated if STAT1 loss was associated with patient outcome
Lan-Juan Zhao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(1-2), 77-90 (2016-11-18)
Signal transducer and activator of transcription (STAT) pathway plays an important role in antiviral efficacy of interferon alpha (IFN-α). IFN-α is the main therapeutic against hepatitis C virus (HCV) infection. We explored effects of IFN-α on HCV replication and antiviral
Yonglei Liu et al.
Oncotarget, 8(24), 39559-39570 (2017-05-04)
Carcinoma associated fibroblasts (CAFs) play important roles in breast cancer development and progression. Recent studies show that microRNAs (miRNAs) are the main regulators in CAFs. MiR-29b is one of the significant down-regulated miRNAs in CAFs from the miRNA screening. The
Makoto Fujii et al.
World journal of gastroenterology, 23(30), 5519-5529 (2017-08-31)
To investigate interleukin (IL)-26 expression in the inflamed mucosa of patients with inflammatory bowel disease (IBD) and the function of IL-26. Human colonic subepithelial myofibroblasts (SEMFs) were isolated from colon tissue surgically resected. The expression of IL-26 protein and its
Bin Huang et al.
Nature communications, 7, 13885-13885 (2016-12-15)
Communication between osteoblasts and endothelial cells (ECs) is essential for bone turnover, but the molecular mechanisms of such communication are not well defined. Here we identify Cxcl9 as an angiostatic factor secreted by osteoblasts in the bone marrow microenvironment. We

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service