Skip to Content
Merck
All Photos(1)

Documents

EHU009931

Sigma-Aldrich

MISSION® esiRNA

targeting human BAMBI

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAAGGTGAAATTCGATGCTACTGTGATGCTGCCCACTGTGTAGCCACTGGTTATATGTGTAAATCTGAGCTCAGCGCCTGCTTCTCTAGACTTCTTGATCCTCAGAACTCAAATTCCCCACTCACCCATGGCTGCCTGGACTCTCTTGCAAGCACGACAGACATCTGCCAAGCCAAACAGGCCCGAAACCACTCTGGCACCACCATACCCACATTGGAATGCTGTCATGAAGACATGTGCAATTACAGAGGGCTGCACGATGTTCTCTCTCCTCCCAGGGGTGAGGCCTCAGGACAAGGAAACAGGTATCAGCATGATGGTAGCAGAAACCTTATCACCAAGGTGCAGGAGCTGACTTCTTCCAAAGAGTTGTGGTTCCGGGCAGCGGTCATTGCCGTGCCCATTGCTGGAGGGCTGATTTTAGTGTTGCTTATTATGTTGGCCCTGAGGATGCTTCGAAGTGAAAATAAGAGGCTGCAGGATCAGCGGCAACAGATGCTCTCCCGTTTGCACTACAGCTTTCACGG

Ensembl | human accession no.

ENSG00000095739

NCBI accession no.

NM_012342

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BAMBI(25805) , BAMBI(25805)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhao Wang et al.
OncoTargets and therapy, 13, 131-142 (2020-02-06)
Non-small cell lung cancer (NSCLC) is a common malignancy over the world. Previous report indicated that the plasmacytoma variant translocation 1 (PVT1) has been documented to function as an oncogene in various types of human cancers. However, the biological mechanism
Jingjing He et al.
Growth factors (Chur, Switzerland), 34(5-6), 210-216 (2017-02-18)
Fibroblast growth factor-1 (FGF-1) promotes differentiation of human preadipocytes into mature adipocytes via modulation of a BMP and Activin Membrane-Bound Inhibitor (BAMBI)/Peroxisome proliferator-activated receptor (PPARγ)-dependent network. Here, we combined transcriptomic and functional investigations to identify novel downstream effectors aligned with
Long Bai et al.
Cellular signalling, 37, 52-61 (2017-06-05)
Bone morphogenetic protein and activin membrane-bound inhibitor (BAMBI) is a transforming growth factor β (TGF-β) type I receptor antagonist that negatively regulates TGF-β and bone morphogenetic protein (BMP) signaling. BAMBI has been shown to be regulated by TGF-β signaling; however
Longbiao Yang et al.
Molecular medicine reports, 20(4), 3901-3909 (2019-09-06)
To investigate the role of microRNA (miR)‑519d‑3p in postoperative epidural scar formation and its regulation of the bone morphogenetic protein and activin membrane‑bound inhibitor (BAMBI), miR‑519d‑3p and BAMBI expression levels in the lumbar disc of patients who had undergone laminectomy
Christopher Grunseich et al.
Molecular cell, 69(3), 426-437 (2018-02-06)
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service